ID: 1159051690

View in Genome Browser
Species Human (GRCh38)
Location 18:63426427-63426449
Sequence AGGTAGTGACAGAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159051690_1159051697 26 Left 1159051690 18:63426427-63426449 CCCTCTTCATTCTGTCACTACCT No data
Right 1159051697 18:63426476-63426498 TTCTTGGTAGAGTTGTGATTTGG No data
1159051690_1159051694 10 Left 1159051690 18:63426427-63426449 CCCTCTTCATTCTGTCACTACCT No data
Right 1159051694 18:63426460-63426482 TGTCTTCCTGTCTTCCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159051690 Original CRISPR AGGTAGTGACAGAATGAAGA GGG (reversed) Intergenic
No off target data available for this crispr