ID: 1159051690 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:63426427-63426449 |
| Sequence | AGGTAGTGACAGAATGAAGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1159051690_1159051697 | 26 | Left | 1159051690 | 18:63426427-63426449 | CCCTCTTCATTCTGTCACTACCT | No data | ||
| Right | 1159051697 | 18:63426476-63426498 | TTCTTGGTAGAGTTGTGATTTGG | No data | ||||
| 1159051690_1159051694 | 10 | Left | 1159051690 | 18:63426427-63426449 | CCCTCTTCATTCTGTCACTACCT | No data | ||
| Right | 1159051694 | 18:63426460-63426482 | TGTCTTCCTGTCTTCCTTCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1159051690 | Original CRISPR | AGGTAGTGACAGAATGAAGA GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||