ID: 1159054314

View in Genome Browser
Species Human (GRCh38)
Location 18:63449657-63449679
Sequence CAATTTCAACAGAATCACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159054314_1159054316 29 Left 1159054314 18:63449657-63449679 CCCTGGTGATTCTGTTGAAATTG No data
Right 1159054316 18:63449709-63449731 TGTCCATTGATTCTGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159054314 Original CRISPR CAATTTCAACAGAATCACCA GGG (reversed) Intergenic
No off target data available for this crispr