ID: 1159054525

View in Genome Browser
Species Human (GRCh38)
Location 18:63450639-63450661
Sequence CAATTACACCAGAATTTCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159054515_1159054525 15 Left 1159054515 18:63450601-63450623 CCTTAAAAAAATAATGACGCCTG No data
Right 1159054525 18:63450639-63450661 CAATTACACCAGAATTTCTGGGG No data
1159054514_1159054525 23 Left 1159054514 18:63450593-63450615 CCTGGGAACCTTAAAAAAATAAT No data
Right 1159054525 18:63450639-63450661 CAATTACACCAGAATTTCTGGGG No data
1159054518_1159054525 -4 Left 1159054518 18:63450620-63450642 CCTGGGCCCCACCACAGATCAAT No data
Right 1159054525 18:63450639-63450661 CAATTACACCAGAATTTCTGGGG No data
1159054519_1159054525 -10 Left 1159054519 18:63450626-63450648 CCCCACCACAGATCAATTACACC No data
Right 1159054525 18:63450639-63450661 CAATTACACCAGAATTTCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159054525 Original CRISPR CAATTACACCAGAATTTCTG GGG Intergenic
No off target data available for this crispr