ID: 1159060068

View in Genome Browser
Species Human (GRCh38)
Location 18:63505464-63505486
Sequence GGGATGCTTTGGGGTTTTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159060068_1159060076 8 Left 1159060068 18:63505464-63505486 CCCAAAAAACCCCAAAGCATCCC No data
Right 1159060076 18:63505495-63505517 AAATGCTCTTTTGAAGATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159060068 Original CRISPR GGGATGCTTTGGGGTTTTTT GGG (reversed) Intergenic
No off target data available for this crispr