ID: 1159061160

View in Genome Browser
Species Human (GRCh38)
Location 18:63515349-63515371
Sequence AAAAGCAAATTCAGCACCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159061160_1159061161 0 Left 1159061160 18:63515349-63515371 CCAGGGGTGCTGAATTTGCTTTT No data
Right 1159061161 18:63515372-63515394 CTCCTGTTGACGATGTAACTTGG No data
1159061160_1159061163 24 Left 1159061160 18:63515349-63515371 CCAGGGGTGCTGAATTTGCTTTT No data
Right 1159061163 18:63515396-63515418 TTAAAATTTCCCATTAACCACGG No data
1159061160_1159061164 25 Left 1159061160 18:63515349-63515371 CCAGGGGTGCTGAATTTGCTTTT No data
Right 1159061164 18:63515397-63515419 TAAAATTTCCCATTAACCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159061160 Original CRISPR AAAAGCAAATTCAGCACCCC TGG (reversed) Intergenic
No off target data available for this crispr