ID: 1159065008

View in Genome Browser
Species Human (GRCh38)
Location 18:63559928-63559950
Sequence CATTGTGGGTGGAATAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159064998_1159065008 8 Left 1159064998 18:63559897-63559919 CCAGTGTTCAATGTGAGCAGTTT 0: 1
1: 0
2: 1
3: 15
4: 135
Right 1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG 0: 1
1: 0
2: 3
3: 29
4: 266
1159064995_1159065008 28 Left 1159064995 18:63559877-63559899 CCCACAGTTTTCTTCTCTTCCCA 0: 1
1: 0
2: 2
3: 47
4: 562
Right 1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG 0: 1
1: 0
2: 3
3: 29
4: 266
1159064996_1159065008 27 Left 1159064996 18:63559878-63559900 CCACAGTTTTCTTCTCTTCCCAG 0: 1
1: 0
2: 8
3: 69
4: 714
Right 1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG 0: 1
1: 0
2: 3
3: 29
4: 266
1159064997_1159065008 9 Left 1159064997 18:63559896-63559918 CCCAGTGTTCAATGTGAGCAGTT 0: 1
1: 0
2: 1
3: 4
4: 124
Right 1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG 0: 1
1: 0
2: 3
3: 29
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159065008 Original CRISPR CATTGTGGGTGGAATAGAGT GGG Intronic
902663741 1:17923181-17923203 CATTGTGCCTGGCATATAGTAGG - Intergenic
902907766 1:19571477-19571499 CACTGATGGTGGACTAGAGTGGG - Intergenic
903910851 1:26723788-26723810 CATTGGAGGTGGAATGGAGAGGG - Intronic
904858946 1:33520661-33520683 CAGTGTGGGTGGGAAAGGGTGGG + Intronic
906245248 1:44268831-44268853 CTTTGTGGGTGGAAAGGAGAGGG - Intronic
906827212 1:48994140-48994162 CACTGTGGCTGGAATACAGGTGG - Intronic
906949670 1:50323999-50324021 TATTGGGAGTGGAATAGAGTGGG - Intergenic
907424763 1:54372681-54372703 GATTGTGGGTGGAAGAGCGTCGG - Intronic
908048897 1:60206006-60206028 CAATGTGGGAGGGATGGAGTGGG + Intergenic
908789795 1:67770272-67770294 CAAGGTGGGTGGAATGGAGAGGG + Intronic
909180164 1:72413761-72413783 CATGGTGGCTGGACTATAGTGGG + Intergenic
909182539 1:72442460-72442482 CATTGTGGGTGGAGTTGTGGAGG + Intergenic
909747202 1:79112621-79112643 CATTTTTGGTGGAATGGGGTTGG + Intergenic
909894168 1:81045546-81045568 CATTGTGGGTGGTGGAGAGCTGG + Intergenic
910025790 1:82649763-82649785 CAATGTGGATGGAATAGAAGTGG - Intergenic
911355642 1:96816020-96816042 CATTGTGGGTGGGATTGCCTTGG + Intronic
912252125 1:108022039-108022061 AATGGTGGAAGGAATAGAGTTGG - Intergenic
912679727 1:111721405-111721427 CATGGTGGGTGGAGGCGAGTTGG + Intronic
912877862 1:113380412-113380434 CATGGTGGGAGGAAGAGAGTGGG + Intergenic
914256666 1:145965565-145965587 CATTGTGTCTGGCATATAGTAGG - Intronic
915030627 1:152877785-152877807 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
915893508 1:159792851-159792873 AATTGTGGCTGGCATATAGTAGG - Intergenic
916306941 1:163346870-163346892 CATCCAGGGTGGAATGGAGTAGG + Intronic
916976710 1:170088553-170088575 CATTATAGGTCAAATAGAGTTGG - Intergenic
917159504 1:172041609-172041631 CATTGGGGGAGTAATAGAGCTGG + Intronic
917691094 1:177469919-177469941 TATTGTAGGTGGAATTGTGTTGG + Intergenic
917725258 1:177821659-177821681 CATTGTGTGAGGCATAGTGTCGG - Intergenic
919773227 1:201176348-201176370 ACTTGTGGGTGGAAAGGAGTTGG + Intergenic
920768693 1:208858952-208858974 CAGTGTGGTTGGAGTAAAGTGGG + Intergenic
920837911 1:209528859-209528881 CATTCTGTGTGGAAAAGAGGTGG + Intergenic
921056688 1:211547976-211547998 CAGTGTGGCTGAAACAGAGTGGG - Intergenic
921171002 1:212549599-212549621 CATTTGGGGTGGGATAGGGTGGG + Intergenic
922227659 1:223659553-223659575 GATTGTTGGTGGAAGAGAATCGG - Intronic
922750507 1:228068011-228068033 TAGTGTAGGGGGAATAGAGTAGG + Intergenic
922751008 1:228070063-228070085 TAGTGTGGGGGGAATAGTGTAGG + Intergenic
923196555 1:231673970-231673992 CATTGTGTGCAGAATAGGGTAGG + Intronic
1064828830 10:19438689-19438711 CAGTGTGTGTGAAATAGACTTGG + Intronic
1065461360 10:25968792-25968814 CATTCTGGGTGGGATGGAGCAGG - Intronic
1067821074 10:49531119-49531141 CATAGTGTGTTGAATAAAGTAGG - Intronic
1068130939 10:52894343-52894365 CATTTTTGGTGGAATAGACGGGG + Intergenic
1068745557 10:60526581-60526603 CATTGTGGTAGGAATATATTAGG + Intronic
1069688050 10:70331737-70331759 CGTTGGGAGTGGAATGGAGTGGG - Intronic
1071352753 10:84763151-84763173 CATTGTGGTTGGACTACAGCTGG + Intergenic
1071487349 10:86111283-86111305 CATGGTGGGTGGATTTTAGTAGG - Intronic
1071546494 10:86533943-86533965 CATTGTGGCTGGCAAAGAATAGG - Intergenic
1071760614 10:88601484-88601506 CTGTGTGGGTGCTATAGAGTTGG - Intronic
1072064917 10:91858560-91858582 CCTTGGGAGTGGAGTAGAGTGGG - Intronic
1073750140 10:106516300-106516322 CATAGTAGTTGGAATAGATTAGG + Intergenic
1073898540 10:108191607-108191629 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1074647404 10:115474550-115474572 TGTTGTGGGTGAAATAGAGCAGG + Intronic
1077444947 11:2586542-2586564 CACTGTGGGAGGACTGGAGTAGG + Intronic
1077508703 11:2944050-2944072 CATTGTGGATGGAAGAGACACGG + Intergenic
1077537750 11:3132585-3132607 CAGTGTGGCTGGAGCAGAGTGGG - Intronic
1077594398 11:3519243-3519265 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1078823985 11:14908552-14908574 CATGGGGGCTGGAATACAGTAGG + Intronic
1079085937 11:17444940-17444962 AATTGTGGCTGGCATATAGTTGG + Intronic
1080334161 11:31176556-31176578 CTTTTTGGGTGGAATATAATTGG - Intronic
1083019203 11:59489052-59489074 CAGTGTGGTTGGCACAGAGTGGG - Intergenic
1083937290 11:65876564-65876586 CACTGTGGCTGGCACAGAGTGGG - Intergenic
1084250248 11:67892520-67892542 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1084822543 11:71702826-71702848 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
1085488153 11:76886225-76886247 CCCTGTGGCTGGAATAGACTTGG + Intronic
1085630271 11:78109723-78109745 CATTTTGGGTAGAATAGTATAGG - Intronic
1086905948 11:92418133-92418155 GATTGTTGATGGAATAGAGTTGG - Intronic
1087585468 11:100114937-100114959 AATGGTGGGTGGAGTGGAGTGGG - Intronic
1087660851 11:100986394-100986416 CATTGTGACTGGAGTAGAGTAGG + Intronic
1087825035 11:102755367-102755389 CAATGTGGCTGGAGCAGAGTGGG + Intergenic
1088042653 11:105406462-105406484 CTATGTGGCTGAAATAGAGTAGG + Intergenic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088485741 11:110338766-110338788 AATTGTGGGTGGAGAAGAGATGG - Intergenic
1089003597 11:115072369-115072391 CCATGTGGATGGAATAGACTTGG - Intergenic
1089371040 11:117957838-117957860 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
1089908322 11:122068926-122068948 CATTGTAAGTGAAACAGAGTTGG - Intergenic
1089952246 11:122539350-122539372 CATTGTAGGTGGTATATAGTTGG - Intergenic
1090997204 11:131877534-131877556 CATCCTGGGTGGAATAGGGGTGG - Intronic
1092200279 12:6577859-6577881 CATTGAGGATGGCATAGCGTGGG + Exonic
1092420571 12:8328032-8328054 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1093008038 12:14072240-14072262 CATAGTGCCTGGCATAGAGTAGG - Intergenic
1094084385 12:26573761-26573783 CAGTGTGGATGGAGCAGAGTTGG + Intronic
1094554288 12:31482996-31483018 CATTGTTGCTGGAGCAGAGTGGG - Intronic
1098233400 12:68395622-68395644 CGGTGTGGGAGGAATAGAGGTGG - Intergenic
1098678068 12:73315980-73316002 GCTTGGGGGTGGAGTAGAGTGGG + Intergenic
1098832369 12:75377652-75377674 CACTGTGGCTGGAATAAAGCAGG - Intronic
1099711785 12:86235852-86235874 CATAGTGATTGGAATAAAGTTGG + Intronic
1100024118 12:90106794-90106816 CATCCTGGGTGGAATGGAGTGGG + Intergenic
1100673215 12:96838663-96838685 CATTGAGGGAGGAATCTAGTGGG - Intronic
1101132871 12:101707284-101707306 CTTTGTGGGTGGAATGGAGCTGG + Intronic
1101179876 12:102204387-102204409 GATTGTAGATGGAAGAGAGTTGG + Intergenic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101664512 12:106799331-106799353 CATAGTGCTTGGCATAGAGTAGG - Intronic
1102207581 12:111101008-111101030 CATCTTGGTTGGAATAGGGTGGG - Intronic
1102914058 12:116739698-116739720 CACTGTGGGTGGACAGGAGTGGG + Intronic
1104678090 12:130729367-130729389 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
1105665582 13:22552339-22552361 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1107538537 13:41361699-41361721 CGTTCCGGGTGGGATAGAGTGGG + Intronic
1112647554 13:101352100-101352122 CATGCTGTGTGGCATAGAGTAGG - Intronic
1114367055 14:22040404-22040426 CTTTGTAGGTGGCATAAAGTGGG + Intergenic
1114413873 14:22525988-22526010 TATTGTGGGTGGACCAGAGCAGG - Intergenic
1115451890 14:33557376-33557398 CATTGTGGGTAGAAGACAGAGGG - Intronic
1121288456 14:92755097-92755119 CATTGTGGCTGGAGTGGAGCAGG - Intergenic
1121482907 14:94292156-94292178 CATTGTGATGGCAATAGAGTTGG + Intronic
1123576922 15:21679841-21679863 AATTGTGGTTGGAATAGACGCGG - Intergenic
1125754657 15:42055135-42055157 CATGGTGTGTGGAAAAGACTTGG - Intergenic
1127864195 15:63018558-63018580 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1128591205 15:68899169-68899191 CTTTCTGGTTGGAACAGAGTAGG - Intronic
1202985790 15_KI270727v1_random:414086-414108 AATTGTGGTTGGAATAGACGCGG - Intergenic
1133359287 16:5161086-5161108 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
1134138309 16:11695364-11695386 TAGAGTGAGTGGAATAGAGTTGG - Intronic
1135961924 16:27002132-27002154 CAGTGTGGCTGGAAGAGAATAGG + Intergenic
1137365947 16:47859548-47859570 CCTTGTGGGTGGAAGTCAGTAGG - Intergenic
1139084338 16:63565959-63565981 CATTGTGCCTGACATAGAGTAGG - Intergenic
1139665526 16:68452735-68452757 CATGGTGAGTGGAAAAGAGGGGG + Intergenic
1147288195 17:39419957-39419979 CTTTGTGGTTGGAATACAATAGG - Intronic
1148242449 17:46009552-46009574 CATTGTGGGTGGGAGAGGGCTGG + Intronic
1149101880 17:52916843-52916865 TATTGTAGGTAGTATAGAGTTGG + Intergenic
1149341236 17:55688210-55688232 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1151596661 17:75082158-75082180 CTTTGGGGGTGGAATGGAGTGGG - Intergenic
1152723099 17:81932469-81932491 TACTGTGGGTGGAATAGTGGAGG - Intronic
1153342698 18:3991760-3991782 CTTTTTGTGTGGAAAAGAGTAGG - Intronic
1155193246 18:23449976-23449998 CATGGTGGCTGGCATATAGTAGG - Intergenic
1155526663 18:26722514-26722536 CTTTGTTAGTGAAATAGAGTTGG + Intergenic
1159019049 18:63127997-63128019 CCTGGTGGGAGGAAAAGAGTTGG - Exonic
1159065008 18:63559928-63559950 CATTGTGGGTGGAATAGAGTGGG + Intronic
1160311826 18:77799964-77799986 CAATGTTGGAGGAAGAGAGTCGG + Intergenic
1163068353 19:14816406-14816428 CAGTGTGGCTAGAATAGAGCAGG + Intronic
1165387220 19:35517630-35517652 CATTGTGGCTGGAGCAGTGTTGG + Intergenic
1166215664 19:41333056-41333078 CAGTGTGGCTGGAGTGGAGTAGG - Intronic
1166552079 19:43672505-43672527 CAGTGTGGCTGGAACAGATTAGG + Intergenic
1166840807 19:45695815-45695837 CTCTGTGCGTGGAGTAGAGTGGG - Intronic
1167702785 19:51060362-51060384 GATTGTGGATGGGGTAGAGTTGG - Intronic
1167708578 19:51096859-51096881 CAGTGTGGCGGGAACAGAGTGGG - Intergenic
926496559 2:13595463-13595485 CATTATGGCTGGAACAGACTAGG - Intergenic
926841935 2:17090337-17090359 CATTGTGGATGGGATAAAGGAGG - Intergenic
929298482 2:40274148-40274170 CCTTGTGGATGGAATAGACTGGG + Intronic
930511411 2:52349913-52349935 CAGTGTGGCTGCAACAGAGTGGG - Intergenic
930889035 2:56361666-56361688 CAATGTGGCTGGAACAGAGTGGG + Intronic
931176931 2:59863563-59863585 CATTGTTGGGAGAAAAGAGTAGG - Intergenic
932302001 2:70674071-70674093 CAATTTGGGTGGAGTAGAGAGGG + Intronic
932561491 2:72875178-72875200 CAGTGTGGCTGGAATAAAGCAGG - Intergenic
932668458 2:73717024-73717046 CATGGTGAGTGGCAAAGAGTAGG - Intergenic
935028953 2:99303773-99303795 CATTGTGGGAGGGACACAGTGGG + Intronic
937472586 2:122186824-122186846 CGGTGTGGGTGGAAGAGAGATGG - Intergenic
937836867 2:126479949-126479971 CATTGTTGGTGGAATATAAATGG + Intergenic
938701657 2:133885178-133885200 CGGGGTGGGTGGTATAGAGTGGG + Intergenic
939187233 2:138875568-138875590 TATAGTGGGTGGGATAGAATTGG + Intergenic
939288019 2:140157440-140157462 CATGGTGGGTGCAATAGAAGTGG - Intergenic
940586405 2:155657745-155657767 AATTTTGGATGAAATAGAGTAGG + Intergenic
944614916 2:201450927-201450949 CTTTCTGGGTCAAATAGAGTTGG - Intronic
945359975 2:208885567-208885589 CATTGTGGGAGGAATCTGGTGGG + Intergenic
946388000 2:219397512-219397534 GAATGTGGGTGGAATAGGTTTGG + Intronic
946411686 2:219518359-219518381 CATTCTGGGTGGAGGAGAGCTGG + Intronic
948320589 2:237065624-237065646 CATTGTGGGTGGTACAGAGTGGG + Intergenic
948931072 2:241132720-241132742 CAGTGTGTGTGGAAGAGAGCAGG + Intronic
1168857432 20:1018584-1018606 CAGTGGGGCTGGAAAAGAGTGGG - Intergenic
1169005526 20:2204144-2204166 CAGTGTGGCTGGAATGAAGTGGG - Intergenic
1169068041 20:2705556-2705578 CACTGTGGGAGGAAAAGAGCTGG - Exonic
1169275336 20:4229970-4229992 CAATGTGGCTGGAACAGAGTAGG - Intronic
1170590281 20:17766137-17766159 CAGTGTGGCTGGAGCAGAGTGGG + Intergenic
1170875905 20:20249843-20249865 CATCGTGGATGGCTTAGAGTAGG + Intronic
1171413547 20:24962260-24962282 CCTTGTTGGGGGAAGAGAGTCGG - Intergenic
1172041045 20:32046156-32046178 CATTGTGGCTGGAACACAGAGGG - Intergenic
1174068771 20:47885442-47885464 GAGTGTGGGTGCAATAGAGGGGG - Intergenic
1174201995 20:48813075-48813097 CGTTGGGGGTGGAGTAGAGTAGG - Intronic
1174288394 20:49488846-49488868 CAGTGTGGCTGAAATAGAGCAGG + Intergenic
1174299260 20:49569570-49569592 CAGTGTGGCTGGAGCAGAGTGGG - Intergenic
1174514839 20:51083705-51083727 CAGTGTGGCTGGCAGAGAGTGGG + Intergenic
1175072809 20:56348703-56348725 CATTGTGCCTGGCATTGAGTAGG + Intergenic
1175118309 20:56699622-56699644 CAGTGTGGGTGAAATAGACATGG - Intergenic
1175592580 20:60204790-60204812 CATTGTGGGTGGAAAGGCGGTGG - Intergenic
1178617849 21:34149016-34149038 CATTGTGAGTGGAAGAGACAAGG + Intergenic
1179731687 21:43371810-43371832 CATTGTGGGGTGATTTGAGTGGG + Intergenic
1181153635 22:20903154-20903176 CATTGTGCCTGGCACAGAGTAGG + Intergenic
1182219814 22:28749245-28749267 CATTGTGGCTGGAGTGGAGAAGG - Intronic
949374243 3:3369211-3369233 CATTGAAGGTGGAGTAGAGAAGG - Intergenic
949410185 3:3755045-3755067 CATTTTGCCTGGACTAGAGTTGG + Intronic
949484981 3:4529344-4529366 CATTGAGGGTGAAATTGATTTGG + Intronic
949534040 3:4981817-4981839 CATTGTGGGTGTTTTACAGTTGG + Intronic
949571365 3:5296481-5296503 CATTATGAGTGAACTAGAGTTGG - Intergenic
950476591 3:13218947-13218969 CTTGGTGGGTGGCATTGAGTAGG - Intergenic
950677258 3:14561808-14561830 CTCTGTGGGTGGAAGAGAGGAGG + Intergenic
950965709 3:17144341-17144363 CACTGTGGGTGGGAGAGAGGAGG + Intergenic
951141054 3:19160738-19160760 CATCCTGGGTGGGATGGAGTGGG - Intronic
951738162 3:25890886-25890908 GATTATGGGTTGAAAAGAGTTGG + Intergenic
953474349 3:43193328-43193350 TTTTGTGGGTAGAATAGAGGGGG + Intergenic
955503825 3:59611381-59611403 CAGTGTGGCTGGAACACAGTGGG + Intergenic
956246149 3:67185881-67185903 TATTGTGGGAGGAACACAGTGGG - Intergenic
957064533 3:75510608-75510630 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
957151888 3:76497066-76497088 CATTGTGGCTGGAGTGCAGTGGG - Intronic
957264112 3:77939020-77939042 TATTCTTGGAGGAATAGAGTAGG - Intergenic
957515274 3:81242373-81242395 CATTGTCCTTGGAATTGAGTAGG + Intergenic
961288821 3:125828792-125828814 CAGAGTGGCTGAAATAGAGTAGG + Intergenic
961723647 3:128911838-128911860 CATTTTGGATGGAGTACAGTGGG - Intronic
961898249 3:130187234-130187256 CAGAGTGGCTGAAATAGAGTAGG - Intergenic
963670455 3:148245340-148245362 AAATGTGGGGGGAAGAGAGTGGG - Intergenic
963696306 3:148569836-148569858 CTTTGTGGTTGGCACAGAGTAGG - Intergenic
964693389 3:159479692-159479714 AAATGTGGGTGGAGTAGAGGTGG - Intronic
964850852 3:161094936-161094958 CATTGTGGTTGAAATAGGATTGG - Intronic
964895681 3:161591858-161591880 TGTTGTGGGAGGAATACAGTGGG - Intergenic
965666491 3:171099495-171099517 CATGGTGTCTGGAATACAGTGGG - Intronic
966264606 3:178024146-178024168 TATTGTTGGTGGAATAGTGAAGG - Intergenic
968494327 4:907097-907119 CATTGTCAGTGGAATTGAGTCGG - Intronic
969008434 4:4040699-4040721 CATAGTGGCTGAAATAGAGTAGG - Intergenic
969282108 4:6177743-6177765 CATTGGGGGTGGAGTGGAGGAGG - Intronic
969745245 4:9065681-9065703 CATAGTGGCTGAAATAGAGTAGG + Intergenic
969982566 4:11173225-11173247 CAGTGTGGCTGGAATAAAGCAGG + Intergenic
970264591 4:14267497-14267519 CATTGTGCGTTGAATAGATGTGG - Intergenic
970653263 4:18201340-18201362 GATAGTGCCTGGAATAGAGTAGG + Intergenic
970802169 4:19985986-19986008 CATTGTGGGAGGGACACAGTGGG + Intergenic
970888288 4:21012188-21012210 CATTGTGCTTGGTATATAGTAGG + Intronic
971143253 4:23947815-23947837 CAATGTGGGAGGCAGAGAGTGGG + Intergenic
973832616 4:54776916-54776938 GAGTGTGGCTGGAATAGAGTGGG + Intergenic
975934491 4:79562005-79562027 CATTGTGGCTAGAATAAAGCAGG + Intergenic
976598071 4:86912866-86912888 CCTTGTGGATGGATTAGAATTGG - Intronic
976683477 4:87784578-87784600 CACTGTGGCTGGTATAGAATGGG + Intergenic
977449055 4:97171218-97171240 CAGTGTGGCTAGAATAAAGTAGG - Intergenic
977859829 4:101943468-101943490 CATGGTGGGTGGATTGGTGTGGG + Intronic
978058642 4:104308028-104308050 CATTGTGGGTGTTATTGTGTTGG - Intergenic
978723447 4:111942171-111942193 CCTTGTGAATGGATTAGAGTGGG - Intergenic
980376739 4:131958698-131958720 CATTGTGGGAGGAACCTAGTGGG - Intergenic
981048311 4:140286247-140286269 AATTGTGGCTGGCATAGAGTAGG + Intronic
981144124 4:141305089-141305111 CACTGTGGCTGGAGTAGAGAAGG + Intergenic
981598402 4:146454480-146454502 CAGTGTGGATGTAATAGAGAGGG - Intronic
981894441 4:149781359-149781381 CATCCTGGGTGGGATGGAGTGGG - Intergenic
982469796 4:155774248-155774270 CAATGTGGCTGGAACAGAGGAGG - Intronic
983430845 4:167648811-167648833 CATTGTGGGAGGAACCCAGTGGG - Intergenic
986437129 5:7745470-7745492 CATTGTGGGTTGTATAGAGGAGG + Intronic
986844756 5:11739397-11739419 GAATGTGGGTGGAACAGACTTGG + Intronic
988845346 5:35121987-35122009 CATTCTGGGTGGAATAAAGTGGG + Intronic
990672396 5:58147739-58147761 CATTGAGGGTGGAAAAAAGAGGG - Intergenic
991442298 5:66663661-66663683 CACTGTAGCTGGAATAGAGTGGG + Intronic
991642493 5:68768922-68768944 CATTGACGGTGGAAAAGAATGGG - Intergenic
994741219 5:103621877-103621899 GATTAGGGGTGGAATAGGGTTGG + Intergenic
994807335 5:104466367-104466389 CATTGAGGGGGGAAAAAAGTAGG + Intergenic
997399489 5:133591470-133591492 TATTGTGGGTGGAGGACAGTTGG - Intronic
997857901 5:137389944-137389966 CACTGTGGGTGGAGTAGGATGGG - Intronic
998967734 5:147559017-147559039 CACTGTGGGGGAAAAAGAGTAGG + Intergenic
999800294 5:155027185-155027207 CCTTGGGGGAGGAAAAGAGTTGG + Intergenic
1000090356 5:157924787-157924809 TTTTGTGGGTGTCATAGAGTAGG + Intergenic
1000958146 5:167566777-167566799 CATGGTGGACCGAATAGAGTTGG - Intronic
1001748514 5:174110364-174110386 CATGGTGGGTGGGAGAGAGAAGG + Intronic
1001803120 5:174560327-174560349 CACTGTGGGTGGCATAGGGTTGG + Intergenic
1002292347 5:178208691-178208713 CACTGGGGGTGGAATGGGGTAGG - Exonic
1003148355 6:3527695-3527717 GCTGGTGGGTGGAGTAGAGTGGG + Intergenic
1004817633 6:19329880-19329902 CAGTGTGGCTGAAGTAGAGTGGG + Intergenic
1005189350 6:23201996-23202018 CTTTGTGGGTGGATTTGATTTGG - Intergenic
1005808263 6:29495291-29495313 CAGTGTGGGAGGAACAGAGTGGG - Intergenic
1005816865 6:29560171-29560193 CATGGTGGTGGGGATAGAGTTGG - Intronic
1008808248 6:55457929-55457951 CATTGTGGGAGGAAGAGAGAAGG + Intronic
1011547704 6:88499296-88499318 CACTGTGGCTGGAATTGGGTGGG + Intergenic
1011809815 6:91118042-91118064 AAGGGTGGGTGGAATCGAGTAGG - Intergenic
1011897775 6:92253379-92253401 TATTGTGGGAGAAATGGAGTAGG - Intergenic
1013702833 6:112794930-112794952 CACTGTGGTTGGCATTGAGTGGG + Intergenic
1013705686 6:112831234-112831256 CATCCTGGGAGGAACAGAGTGGG + Intergenic
1014583788 6:123171811-123171833 CATTGAGGGTGGGAGAGTGTGGG + Intergenic
1014888499 6:126812610-126812632 TCTTCTGGGGGGAATAGAGTAGG + Intergenic
1017039150 6:150293996-150294018 CATTGTGGGTGGAAGGGACCTGG + Intergenic
1018441719 6:163820061-163820083 CAGTGTGGCTGGAATAGCGGAGG - Intergenic
1018582859 6:165322663-165322685 CATTGTGGGAGGAACCCAGTGGG + Intergenic
1018927020 6:168213464-168213486 CATTGTGAGTGGGATCGCGTTGG + Intergenic
1020328901 7:6998491-6998513 CATAGTGGCTGAAATAGAGTAGG - Intergenic
1021437251 7:20633379-20633401 CATTTTGGGGGGAAAAGAATAGG - Intronic
1022888993 7:34676701-34676723 CACTGTGTCTGGCATAGAGTAGG + Intronic
1025095087 7:56090503-56090525 CATGGTGGTTGGCAAAGAGTGGG - Intronic
1029030326 7:97460129-97460151 TATTGTGGGAGGAATCCAGTGGG + Intergenic
1029796098 7:102896082-102896104 CAGAGTGGCTGGAGTAGAGTTGG + Intronic
1030642705 7:112024389-112024411 GATTGTGGGTTGAGTAGGGTGGG - Intronic
1032619821 7:133517704-133517726 TATTGTGGGAGGAATCCAGTGGG - Intronic
1032882071 7:136100476-136100498 CATGGTGGGTGGGGTTGAGTGGG + Intergenic
1033668301 7:143464698-143464720 CATCGTGGTTGGAATAGTCTTGG + Intergenic
1034026060 7:147705955-147705977 TCTTGTGGGTGGAAGAGAGTTGG + Intronic
1036249722 8:7151381-7151403 CATAGCGGCTGAAATAGAGTAGG - Intergenic
1036367731 8:8135666-8135688 CATAGTGGCTGAAATAGAGTAGG + Intergenic
1036461967 8:8961319-8961341 CATTGTGGGAGGAACCCAGTGGG - Intergenic
1036702314 8:11020929-11020951 CATAGTGGCTGGCACAGAGTAGG + Intronic
1036883150 8:12529995-12530017 CATAGTGGCTGAAATAGAGTAGG - Intergenic
1038053570 8:23836611-23836633 CATAGTGGGAGGGGTAGAGTAGG + Intergenic
1042339202 8:67661311-67661333 CATTGTGGCTGGAGTAGAGTAGG + Intronic
1042819766 8:72917070-72917092 AATTCTGGGTGGAAGAGGGTGGG - Intronic
1043614023 8:82103355-82103377 CAGTGTGGCTAGAATAAAGTGGG + Intergenic
1046752210 8:117938043-117938065 CATTGGGTTTGGAATAGTGTGGG - Intronic
1047992558 8:130301294-130301316 GTTTGTGGGTGGAATAAAGGAGG - Intronic
1048678564 8:136812873-136812895 CATTTTGGGTGGCATTGAGGTGG - Intergenic
1051033114 9:12707545-12707567 AACTGTGGCTGGAGTAGAGTGGG + Intronic
1051363587 9:16303991-16304013 CCTTGTGGCTGGAAGAAAGTAGG - Intergenic
1056395400 9:86176727-86176749 CATGGTGGGTGAATTAGAGATGG + Intergenic
1057834788 9:98435650-98435672 CAGTGTGGCTGGAATAAAGTGGG - Intronic
1059943550 9:119382397-119382419 CCTCGTGGGTGTAATAGAGCAGG - Intergenic
1060070519 9:120543026-120543048 AACTGTGTTTGGAATAGAGTTGG + Intronic
1060082297 9:120661124-120661146 AAGTGTGGGAGGTATAGAGTTGG - Intronic
1060463666 9:123883000-123883022 CATTGTGGCTGGAGTTCAGTGGG - Intronic
1188117722 X:26265509-26265531 CACCCTGGGTGGAATGGAGTAGG - Intergenic
1189337309 X:40177670-40177692 CATTGTGGCTGGCATATAGTAGG + Intergenic
1191015519 X:55805901-55805923 CATTGTGGATAGAATTCAGTAGG - Intergenic
1191681747 X:63847831-63847853 CCTTTGGGGTGGAATTGAGTTGG - Intergenic
1191690779 X:63935757-63935779 CATCCTGAGTGGAATAGACTAGG - Intergenic
1194925915 X:99823326-99823348 CATAGTGGCTGGCATATAGTGGG - Intergenic
1195404020 X:104492980-104493002 CATTGTGGGGGCAGTAGGGTAGG + Intergenic
1199245165 X:145595743-145595765 CCTTGTAGGTGGCATATAGTTGG - Intergenic
1199758726 X:150889176-150889198 CACTGTGGGTGAAACAGAGCAGG - Intronic