ID: 1159065785

View in Genome Browser
Species Human (GRCh38)
Location 18:63566825-63566847
Sequence TATCCACAAAACCTTTGTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 124}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159065783_1159065785 -1 Left 1159065783 18:63566803-63566825 CCAATTTGTACTTGTCAAAAATT 0: 1
1: 1
2: 2
3: 34
4: 403
Right 1159065785 18:63566825-63566847 TATCCACAAAACCTTTGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 124
1159065782_1159065785 0 Left 1159065782 18:63566802-63566824 CCCAATTTGTACTTGTCAAAAAT 0: 1
1: 0
2: 3
3: 41
4: 475
Right 1159065785 18:63566825-63566847 TATCCACAAAACCTTTGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 124
1159065781_1159065785 6 Left 1159065781 18:63566796-63566818 CCAAGTCCCAATTTGTACTTGTC 0: 1
1: 0
2: 0
3: 8
4: 100
Right 1159065785 18:63566825-63566847 TATCCACAAAACCTTTGTGGAGG 0: 1
1: 0
2: 1
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159065785 Original CRISPR TATCCACAAAACCTTTGTGG AGG Exonic
901249531 1:7765618-7765640 TCTCCACAAAACCTGTGTGAAGG + Intronic
902599156 1:17529473-17529495 CATCCACAGCACCTGTGTGGAGG - Intergenic
904050357 1:27634790-27634812 TACCCACTAGACCTTTTTGGGGG + Intronic
906442633 1:45862295-45862317 TATCCACAAAGGATTTGAGGTGG + Intronic
910796831 1:91105853-91105875 TGTCCATAAAACTTTTTTGGGGG - Intergenic
911863650 1:102988347-102988369 TATCCTCCAAATTTTTGTGGAGG + Intronic
911940900 1:104046280-104046302 TATCCACACAACAATAGTGGGGG - Intergenic
912573647 1:110643864-110643886 TATCCATAAATCATTTGTTGGGG + Intergenic
913194937 1:116448458-116448480 TATCCACAAAGGCTTCCTGGAGG - Intergenic
914692725 1:150045389-150045411 CAGCCAGAAAACCTTTGTGGAGG + Intergenic
918823150 1:189285443-189285465 TATCCACATAAGGTTTGGGGAGG + Intergenic
918850940 1:189689445-189689467 TATCCAGAAAACATTTATGGAGG + Intergenic
920718988 1:208369345-208369367 TCTCCACAAATACTTTTTGGTGG + Intergenic
921373935 1:214453857-214453879 GATCCTCAAAATCTTAGTGGAGG - Intronic
1063840627 10:10068264-10068286 TTTCCACAAATGATTTGTGGAGG + Intergenic
1068506943 10:57912709-57912731 AATCCTCAATACCTTTCTGGAGG - Intergenic
1069042868 10:63712735-63712757 CATCCTCAAAACTTTTGTAGTGG + Intergenic
1069128198 10:64664863-64664885 TCTTTACAAAAACTTTGTGGTGG - Intergenic
1071681941 10:87715014-87715036 TATCCACGAACTCTTTGTGCCGG + Exonic
1072255328 10:93615304-93615326 AATCCACAAAACCATATTGGTGG + Intronic
1075029806 10:119015326-119015348 TATGTACAAGACCTTTATGGAGG - Intergenic
1076115590 10:127895319-127895341 TTTCTACAAACCCTTTTTGGTGG + Intergenic
1080256164 11:30292856-30292878 CGTCTACAAAACCTTTGAGGTGG + Intergenic
1081508956 11:43748507-43748529 TATCCTCACTACCTGTGTGGTGG + Intronic
1085266919 11:75242626-75242648 AATCCACAAAACCATTCTGATGG - Exonic
1085847032 11:80077711-80077733 TATCTGCAAAACCTTCCTGGGGG - Intergenic
1087822575 11:102728978-102729000 GATCCACAAAGTCTTTGTAGGGG + Intergenic
1094060340 12:26308316-26308338 TATCCACAAAATCATTGTCAAGG - Intergenic
1099715195 12:86284093-86284115 TATTCACAAAAACAGTGTGGAGG - Intronic
1100686512 12:96992257-96992279 TAACCATAAAAGCTTTGTGAAGG + Intergenic
1106885523 13:34180774-34180796 TATCCACAAAATCTTTGTATAGG + Intergenic
1107079160 13:36355963-36355985 TATACACAAATCCTTTGGGAAGG + Intronic
1108398283 13:50011703-50011725 TATACACAAGGCCTTTGTGTGGG - Intronic
1109081024 13:57901831-57901853 TCTCCCCAAAATCTTTGTGTAGG + Intergenic
1109645497 13:65249095-65249117 TTTCCACAAAATCTTTCTAGTGG - Intergenic
1112394051 13:99012425-99012447 TGTGCACCAAGCCTTTGTGGAGG - Intronic
1113604079 13:111592419-111592441 TGTCCGCTAAAACTTTGTGGTGG - Intronic
1114073243 14:19131970-19131992 TATCCACAGAGCCTTTGAAGAGG + Intergenic
1114089023 14:19268013-19268035 TATCCACAGAGCCTTTGAAGAGG - Intergenic
1114325098 14:21581056-21581078 TTTCCACCAAACTTTTGTGGAGG + Intergenic
1114909658 14:27174610-27174632 AATCCACAAAACATTTGTTTAGG - Intergenic
1116859994 14:49987150-49987172 TATGCACAAAACCTCACTGGAGG - Intronic
1118595695 14:67433626-67433648 TATCAAAAAAATTTTTGTGGGGG + Intergenic
1120153049 14:81059030-81059052 CATGCACATAACCTTTGTGGAGG - Intronic
1120268547 14:82281417-82281439 TATCTACAAAGACCTTGTGGGGG + Intergenic
1120755412 14:88239442-88239464 TGTCCACCAAAACTTTGTGTTGG + Intronic
1134046677 16:11106285-11106307 TATCCACCAAACTTTTTTGTGGG + Intronic
1135248543 16:20879733-20879755 TACCCAGAAATCCTTTGGGGAGG - Intronic
1135498213 16:22970960-22970982 TTTCCAGAAAAACTTTGTAGAGG + Intergenic
1135530969 16:23254343-23254365 AATGGATAAAACCTTTGTGGAGG + Intergenic
1136362420 16:29789583-29789605 TATACACAAAACATCTTTGGAGG + Intergenic
1138010200 16:53372539-53372561 TACCCATAAAACTTTTGTGCTGG + Intergenic
1140555515 16:75916739-75916761 TATCCCCAGAACCTGTGCGGAGG + Intergenic
1143555280 17:7655973-7655995 TATCAAAAATACCTTTGGGGTGG - Exonic
1145087813 17:19957563-19957585 TAGTCACAAGACCTTTGTGCAGG - Intronic
1150234090 17:63578540-63578562 GATCCACATGAGCTTTGTGGTGG - Exonic
1153674906 18:7448506-7448528 TTTCTACAAAACCTTTGGGTGGG + Intergenic
1156067170 18:33157633-33157655 TTAACACAAAACCTTTCTGGGGG + Intronic
1159065785 18:63566825-63566847 TATCCACAAAACCTTTGTGGAGG + Exonic
1161878590 19:6931265-6931287 TCAGCACAAAACCTCTGTGGAGG - Intronic
925244452 2:2368223-2368245 TATTCACAAAAGTTTTGTGAAGG - Intergenic
933581588 2:84132756-84132778 GATCCACAAAACCTCAGTGTAGG - Intergenic
935514475 2:104019639-104019661 TATTCAGAAAGGCTTTGTGGAGG + Intergenic
935527642 2:104190715-104190737 CATCCAACAAACCTTTGTTGGGG - Intergenic
935663669 2:105490981-105491003 TATCCAGAAAACATTTGGGCAGG - Intergenic
936099095 2:109559621-109559643 TATCCTCATTACCTTTTTGGGGG + Intronic
943192092 2:184691097-184691119 TATGCACAACACTTTTGTGTTGG + Intronic
944082928 2:195810170-195810192 TATCTACAAAGCATTTCTGGGGG + Intronic
944363242 2:198884058-198884080 TATGCTCAGAATCTTTGTGGAGG + Intergenic
945254844 2:207794982-207795004 CATCCACAAAATCTTTCTGAGGG - Intergenic
946502865 2:220268275-220268297 CATCCATAAAACCTTTTTTGGGG - Intergenic
1169993849 20:11534675-11534697 TATCCAGAAAACCTATGTATAGG + Intergenic
1175653676 20:60750512-60750534 TACCCCCAGAACCCTTGTGGTGG - Intergenic
1177685577 21:24433641-24433663 TATGCATAAAACATATGTGGTGG + Intergenic
1178635956 21:34303800-34303822 TTTCAAGAAAACCTTTATGGTGG + Intergenic
1179407764 21:41139647-41139669 TAAGCACAAAACCTCTGTGGGGG - Intergenic
1180491684 22:15854323-15854345 TATCCACAGAGCCTTTGAAGAGG + Intergenic
1180918112 22:19503793-19503815 GAGCCACAAAACCTTTGAAGAGG + Intronic
1184044829 22:41966548-41966570 CAACCACAAAACCATTGTGGTGG - Intergenic
956405485 3:68924526-68924548 CATCCACAGAACCTTTTTCGTGG - Intronic
957601798 3:82345105-82345127 TATGCACACAACCTTTAAGGAGG + Intergenic
958107693 3:89098531-89098553 TTTCCACAATACCTTTGTGAAGG + Intergenic
961565648 3:127761612-127761634 AACCCACAGTACCTTTGTGGTGG - Intronic
963647712 3:147937336-147937358 TTTCCCCAAACCCTTTGAGGTGG + Intergenic
967888580 3:194349056-194349078 TATGTACAAAATATTTGTGGTGG + Intronic
968209709 3:196838697-196838719 TATCCTCAAATACTTTGTGCAGG - Intergenic
971159594 4:24120467-24120489 TATCTACAAAGTCTTTATGGGGG - Intergenic
975986566 4:80206387-80206409 TGTCCACAAGACCATTTTGGCGG + Intergenic
978052227 4:104215805-104215827 TATTCTCAAATCATTTGTGGGGG - Intergenic
980624201 4:135351216-135351238 TATTCACAAAACTTTTCTGTTGG + Intergenic
982243844 4:153328890-153328912 TATCTTCAGACCCTTTGTGGGGG - Intronic
982667217 4:158279790-158279812 GATACACAGAACATTTGTGGTGG + Intergenic
982791296 4:159594776-159594798 AATCCAGCAATCCTTTGTGGAGG + Intergenic
999321259 5:150616535-150616557 TATCTAGAAATCATTTGTGGAGG - Intronic
1001576752 5:172769854-172769876 TACCCACAAAAACTTTCTGCTGG + Intronic
1003624429 6:7728458-7728480 TTGCCACAGAACATTTGTGGCGG - Intronic
1004141222 6:13019767-13019789 TATCCATAAAACTTTAATGGGGG + Intronic
1004163943 6:13239127-13239149 GATCCACAAAGCCTGGGTGGGGG + Intronic
1004600051 6:17141047-17141069 TATACACAAAACCTTCATGTAGG + Intergenic
1005727086 6:28660063-28660085 TAACCATAACACCTGTGTGGTGG - Intergenic
1005790804 6:29297882-29297904 TCTCCACAAAACTTTTGTAAGGG + Intergenic
1008813735 6:55537791-55537813 TGTCCTCAAAAGCTATGTGGGGG + Intronic
1008897829 6:56578125-56578147 TGTGCACAAAACATTTGGGGAGG + Intronic
1012633519 6:101504706-101504728 CATTAACAAAGCCTTTGTGGAGG + Intronic
1014591423 6:123276683-123276705 TATCCAGGAAACATCTGTGGAGG + Intronic
1017557847 6:155591937-155591959 TAACCACAAAAAGTGTGTGGGGG - Intergenic
1017770655 6:157641995-157642017 TATACACAAAAGCTCTTTGGCGG - Intronic
1020393040 7:7680972-7680994 TATCCACATAACTTTTTTTGTGG + Intronic
1023151758 7:37208015-37208037 AAACCACAACACCTTTGAGGAGG - Intronic
1027440296 7:78212247-78212269 TATCCTCAAAACCTGCGTGTAGG + Intronic
1028396373 7:90373091-90373113 TGTACACAAAGCCTTAGTGGTGG + Intronic
1029035810 7:97520163-97520185 TATTTAAAAAACCTTTCTGGAGG - Intergenic
1031107128 7:117557877-117557899 TATTCAAAAAATATTTGTGGAGG - Intronic
1031463635 7:122081790-122081812 TATCCTCAATACTTTTTTGGTGG - Intronic
1032853816 7:135817538-135817560 TATATACAAAACCTCCGTGGTGG - Intergenic
1039074037 8:33672705-33672727 TATCCACAAAAACTGGGTAGTGG + Intergenic
1040964557 8:53071231-53071253 TATGCCCAAGACCCTTGTGGTGG - Intergenic
1043981454 8:86645494-86645516 TATGCACACAACCCTTTTGGGGG - Intronic
1047226182 8:122956993-122957015 CATACAGAAAACCTTTGGGGAGG + Intronic
1047990751 8:130283989-130284011 TATCCACAAAAACCTTGTGGAGG + Intronic
1051279436 9:15426784-15426806 TACCCACAAATCCTGTTTGGAGG - Intronic
1188251251 X:27897764-27897786 TATCCAAAATACATATGTGGAGG + Intergenic
1191784699 X:64904746-64904768 TCTTCACAAAAGCTTTATGGAGG - Intergenic
1192703306 X:73499360-73499382 TATCTACAAAACCCTTGGTGGGG + Intergenic
1193484695 X:82072176-82072198 TTTCCAGACATCCTTTGTGGAGG + Intergenic
1195779588 X:108447069-108447091 TATGCACAAAACTCTTCTGGGGG - Intronic
1197699865 X:129591219-129591241 CATCCACAATACCTTTGCTGTGG - Exonic
1200133909 X:153865431-153865453 TATCCACAAAGACCATGTGGTGG - Exonic
1201964620 Y:19718279-19718301 TATTCACAATAGCTTAGTGGTGG + Intronic
1201989950 Y:20012604-20012626 AATGCACAAAATCTATGTGGAGG + Intergenic
1202080883 Y:21083033-21083055 TATTCACAACACCTTAGTGCTGG - Intergenic
1202277365 Y:23137130-23137152 TAGCCATAAAACATTTGTTGAGG - Intronic
1202288663 Y:23283558-23283580 TAGCCATAAAACATTTGTTGAGG + Intronic
1202430357 Y:24770853-24770875 TAGCCATAAAACATTTGTTGAGG - Intronic
1202440435 Y:24899234-24899256 TAGCCATAAAACATTTGTTGAGG + Intronic