ID: 1159067877

View in Genome Browser
Species Human (GRCh38)
Location 18:63589798-63589820
Sequence CTGGGGAAAAGGACTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 517}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159067877 Original CRISPR CTGGGGAAAAGGACTGAGAA AGG Intronic
900034611 1:396595-396617 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900055442 1:626483-626505 CTAGAGAAAAGGACAGTGAATGG + Intergenic
900429025 1:2593313-2593335 CTGGGGACAAGGACTGCCCACGG + Intronic
900597979 1:3491083-3491105 CGAGTGCAAAGGACTGAGAAGGG - Intronic
900827531 1:4938786-4938808 CTCTGGAGGAGGACTGAGAAGGG - Intergenic
902543593 1:17172108-17172130 TTGGGGACAAGGGTTGAGAAAGG + Intergenic
902595725 1:17508276-17508298 CTGGGAAAAAGGAATGTGACTGG + Intergenic
902800816 1:18828911-18828933 CTGGGAGAAAGGACTGAGAATGG + Intergenic
903172020 1:21560289-21560311 CTGGGTAGAAGGAATGAGCATGG + Intronic
903999442 1:27330695-27330717 GTGAGGAAAAGGACGGGGAAGGG - Intronic
904105548 1:28079064-28079086 CTGGGGAAAAAAAATGAGAATGG - Intronic
904254183 1:29244092-29244114 CTGGGGAGAAAGATTGAGATGGG + Intronic
905406149 1:37733725-37733747 TTGGGGGAGAGGAATGAGAAGGG - Intronic
905863472 1:41364892-41364914 CTGGAGGAAACGACTGGGAATGG - Intronic
905975410 1:42170648-42170670 CTAGGGAAAAGGAAAAAGAAAGG + Intergenic
906263460 1:44410178-44410200 CTGGAGAAAAGAAATGTGAAGGG - Intronic
906536948 1:46556325-46556347 CTGGGGAGGTGGGCTGAGAAAGG + Intergenic
909988561 1:82192912-82192934 GTGGGGACAAGGACTGAGTGGGG - Intergenic
910408973 1:86920199-86920221 ATGGGGAAAATAATTGAGAATGG + Intronic
911372138 1:97006353-97006375 CTGGGGAATGGGACTCAGAATGG + Intergenic
911505447 1:98744176-98744198 CTAGGAAATATGACTGAGAATGG - Intronic
912066730 1:105754323-105754345 CTGGAGAACAGGTATGAGAAAGG + Intergenic
912944123 1:114070449-114070471 CTGGAGAACAGGCATGAGAATGG - Intergenic
913978117 1:143481720-143481742 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
914072521 1:144307349-144307371 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
914106633 1:144659007-144659029 CTGGAGAAAGGCACTGGGAAAGG + Intergenic
914227125 1:145729789-145729811 GTGTGGAAATGGAGTGAGAATGG - Intronic
914245729 1:145884800-145884822 CTGGGGAAAAGCAGGCAGAAAGG + Intronic
915079915 1:153345081-153345103 ATGAGGAAAAGGGATGAGAAGGG + Intronic
915581482 1:156815656-156815678 CAGGAGAGAAGGACTGAGACGGG + Intronic
915727035 1:158025333-158025355 CTCGGGGAAACGACAGAGAAAGG + Intronic
915922628 1:159988118-159988140 CCATGGAAAAGAACTGAGAATGG + Intergenic
918407191 1:184222919-184222941 CTGGGGACATGGAAAGAGAAAGG - Intergenic
919241508 1:194922233-194922255 CTGGAGAACAGGCATGAGAATGG + Intergenic
919255805 1:195122840-195122862 CTTGGAAGAAGGACAGAGAAAGG - Intergenic
919409205 1:197222697-197222719 CAGGGGAAATGAACTGAGAATGG - Intergenic
919739424 1:200973186-200973208 CTGGGCCAAAGGCCTGAGAAAGG + Intronic
919775892 1:201193852-201193874 CTGGGAAGAAAGAGTGAGAAAGG - Intronic
919892996 1:201989710-201989732 CTGGAGAGAGGGAGTGAGAAAGG - Intronic
919913111 1:202123913-202123935 CAGGGGAGAAGGGCTGAGGAAGG - Intronic
919920946 1:202166116-202166138 CTGAGGATGAGGAGTGAGAATGG - Intergenic
919925246 1:202188736-202188758 CTGGGTGCAGGGACTGAGAAGGG - Intergenic
920804876 1:209223607-209223629 CTGGGGAATGGAGCTGAGAAAGG - Intergenic
921678672 1:218006257-218006279 GTGGGCAAAGGGAGTGAGAAAGG - Intergenic
921819115 1:219596437-219596459 CTGGAAAAGAGGAGTGAGAAGGG + Intergenic
922085513 1:222343253-222343275 CTGGGGAAAGGGAGTCAGGAAGG + Intergenic
922225269 1:223640563-223640585 GTGAGGAAAAGGAATCAGAATGG - Intronic
922256968 1:223900800-223900822 CTGAAGAAAAGGACAGTGAATGG + Intergenic
922319427 1:224472630-224472652 CTGGGGAAAAGGATTGAGGATGG + Intronic
923434873 1:233958353-233958375 CTAAGGAAAAAGAGTGAGAAAGG - Intronic
923546027 1:234923825-234923847 CTGGGGATGAGGAATGAGATGGG - Intergenic
923565349 1:235072287-235072309 CTGCGGAAAAGCCCTGAGAGGGG - Intergenic
924338163 1:243003613-243003635 CTGGAGAAAAGGACAGTGAATGG + Intergenic
924938823 1:248795680-248795702 CTGGGAAAAGGCAGTGAGAAAGG - Intergenic
1063191289 10:3697222-3697244 CTGGGGAGGAGGAATGAGGATGG - Intergenic
1063469808 10:6275247-6275269 CTCTGGAAGAGGACAGAGAAGGG - Intergenic
1063545054 10:6972804-6972826 CTGTGTAAAAGGATAGAGAAAGG - Intergenic
1063741413 10:8825595-8825617 GTGTAGAAAAAGACTGAGAAGGG + Intergenic
1064510480 10:16084437-16084459 CGGGGGAAAAGGAAAAAGAAAGG - Intergenic
1065087651 10:22195972-22195994 CAGAGGAAATGGGCTGAGAAAGG + Intergenic
1065559452 10:26947383-26947405 CTGGGGATAAGTACTAAGATGGG + Intergenic
1066427997 10:35326345-35326367 CTTGGGGAGAGGAATGAGAAAGG + Intronic
1067332852 10:45337946-45337968 CTGGAGAACAGGCATGAGAATGG + Intergenic
1067522541 10:47019223-47019245 CTGGGGAAAAAGAAGGAGATTGG + Intergenic
1068012926 10:51477217-51477239 CTGGGGAGCATCACTGAGAAAGG + Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068100142 10:52542405-52542427 TTGGGGAATGGGTCTGAGAAAGG + Intergenic
1069712113 10:70496404-70496426 GTGGGGGAAAGGACCGGGAAGGG - Intronic
1069891317 10:71654180-71654202 CTGGGGACATGGACTCGGAAGGG + Intronic
1070494825 10:77011915-77011937 TTGGGGAATAGGAATGAGAAAGG + Intronic
1070735443 10:78860832-78860854 CTGGGGAAAAGGGCAAAGGAAGG - Intergenic
1070938441 10:80320770-80320792 CTGGGGAAATGCACATAGAAGGG - Intergenic
1071464849 10:85929748-85929770 CTGGGGAGCAGGACTGGGAGTGG - Intronic
1071871068 10:89795290-89795312 ATTGGAAAAAGAACTGAGAAAGG + Intergenic
1072419425 10:95277267-95277289 CTGGGGAAAAAGGCTGGCAATGG - Intronic
1073318152 10:102597323-102597345 CTGGGGAAAAGGAAGGAGGAAGG - Intronic
1073322851 10:102626135-102626157 CTGGGGACAAGGACAGGGAGGGG + Intronic
1073930447 10:108568075-108568097 CTGGGGAAGAGGACAGGGAGGGG - Intergenic
1074198784 10:111212930-111212952 CTGGTGCAAGGCACTGAGAAAGG - Intergenic
1077937096 11:6799836-6799858 CTGGGGCAGAGGACAGGGAAGGG + Intergenic
1078084164 11:8223953-8223975 CTGGGGAAAAGGTCAGAGCTGGG + Intergenic
1078462603 11:11526027-11526049 GTGGGGGAAAGGTATGAGAAAGG + Intronic
1078488745 11:11749516-11749538 GTGGGGATAATGACTGAGAGGGG + Intergenic
1078541955 11:12220113-12220135 CTTGGCAAAAGGACTTGGAATGG - Intronic
1078565763 11:12412658-12412680 CTGGGGCAAAGGACAGTGAGGGG - Intronic
1079081457 11:17416088-17416110 TTGGGGACAAGGAGGGAGAAAGG + Intronic
1080370734 11:31638541-31638563 CTGACGAAAAGGAGGGAGAAAGG + Intronic
1080379117 11:31749091-31749113 CTGGGGAAAATAACTGAGATGGG + Intronic
1080930454 11:36804815-36804837 CTGGGGAAAGAGTCTGAGAAAGG + Intergenic
1081103836 11:39039325-39039347 TTGGGGAGAAGGAGTCAGAAGGG + Intergenic
1082002918 11:47403581-47403603 CTGGAAAGAAGGATTGAGAAAGG + Intergenic
1082988557 11:59187827-59187849 CTGGGGAGAAGGACAGAAAGGGG + Intronic
1083161630 11:60857973-60857995 CTGGAAACAAGGACTGAGAAGGG - Intergenic
1083723213 11:64613936-64613958 CTGAGGGAAAGGGCTGGGAAAGG + Intronic
1083778037 11:64903664-64903686 GGGGGGAACAGGGCTGAGAAGGG + Intronic
1084432234 11:69117514-69117536 CTGGGGAAGGGGAGCGAGAAGGG + Intergenic
1084753594 11:71220764-71220786 CTGGGGAAGAGGAATGGGGAGGG + Intronic
1085510955 11:77087977-77087999 CTGGGGAGATGCACGGAGAATGG + Intronic
1085839780 11:79998352-79998374 CTGAGGATCAGGAATGAGAATGG + Intergenic
1086404105 11:86485679-86485701 CTGGGTAAAAGGGGAGAGAATGG - Intronic
1087639254 11:100737891-100737913 CTGAGGAAGAGGAATGAGAGGGG - Intronic
1087676770 11:101172314-101172336 CCAAGGAAAAGGACTGAAAATGG - Intergenic
1088421780 11:109656558-109656580 CAGAGGAAGAGGACTGACAAAGG - Intergenic
1088432388 11:109773142-109773164 CTGAGGAAAAGAACTCAGAGAGG - Intergenic
1089094394 11:115906654-115906676 CTGTGGAACAGGGATGAGAAGGG + Intergenic
1089136120 11:116250678-116250700 TGGGGGAAAAGGGCTGTGAAGGG - Intergenic
1089625576 11:119748814-119748836 GTGGTGAGAAGGACAGAGAAGGG + Intergenic
1089829415 11:121313097-121313119 CTGGGGAGAATGACTGCAAACGG - Intergenic
1090393295 11:126403279-126403301 CTGGGGAAGAGGTCGAAGAAGGG + Intronic
1090785864 11:130046745-130046767 CGTGGGAAAAGTACTTAGAATGG + Intergenic
1091553204 12:1552508-1552530 GGGGTGAAAAGGACGGAGAATGG - Intronic
1091554191 12:1559886-1559908 CTGGGGAGAAGGAGTAAAAATGG - Intronic
1091555344 12:1569306-1569328 CTGGTGAAAAGGAGAGGGAATGG - Intronic
1091690911 12:2596853-2596875 CTTGTCAAAAGGACAGAGAATGG - Intronic
1091712517 12:2752116-2752138 CTGGGAAAAAGGCATGTGAAGGG - Intergenic
1092236592 12:6814499-6814521 CTTGGGAAAAGGAAAGAAAAGGG + Intronic
1095485607 12:42681257-42681279 CTGAGGAACAGGACTGGGGAAGG - Intergenic
1096097334 12:48944719-48944741 GTGTGGAAAATGGCTGAGAATGG - Intronic
1096412538 12:51387770-51387792 TTGGGGGAAAGGACAGAGAAGGG + Intronic
1096546948 12:52346632-52346654 CTGGGGAATAAAACTGTGAATGG + Intergenic
1096561452 12:52438652-52438674 CTGCTGAAATGGACTGAGAGGGG - Intergenic
1096679457 12:53245677-53245699 CTGGGGGAAAAAAATGAGAAGGG + Intergenic
1096917440 12:55048335-55048357 CTGGGCAAATGGAGAGAGAATGG + Intergenic
1098181848 12:67855557-67855579 CTGGGGAACTAGACTCAGAATGG - Intergenic
1098205517 12:68105243-68105265 CTGGGTAACAGGACAGAGAAGGG - Intergenic
1098780930 12:74685592-74685614 CTGGAGATAAGGACTGACAGGGG + Intergenic
1098986073 12:77013728-77013750 CTGAGGAAGAGGAAGGAGAAGGG - Intergenic
1099393984 12:82115697-82115719 ATGGGGAAAATCACTGGGAAGGG + Intergenic
1099510929 12:83536403-83536425 TTGTGACAAAGGACTGAGAATGG - Intergenic
1100043893 12:90355199-90355221 CAGGGAGAAAAGACTGAGAATGG + Intergenic
1101272655 12:103163909-103163931 CTGGGGAAAAAGGCTCAGAGAGG + Intronic
1101888728 12:108692166-108692188 CTGGGGGACAGGACTGGGAGGGG - Intronic
1102231519 12:111265789-111265811 ATGGGGGAAAGGACTGGGAGAGG - Intronic
1102843598 12:116153288-116153310 CTTGGCAAATAGACTGAGAAAGG - Intronic
1102855398 12:116289013-116289035 CTGGGGAAAAGGGCTCTGCAAGG - Intergenic
1103124553 12:118410153-118410175 CTGGGGACAAACAGTGAGAAAGG - Intronic
1104049069 12:125184506-125184528 CTGGGGAAAGGGTCACAGAAAGG + Intergenic
1104643188 12:130480330-130480352 CTCCAGGAAAGGACTGAGAAGGG + Intronic
1105925634 13:25005116-25005138 CTCGGGGACAGGACTGAGAACGG - Intergenic
1106039068 13:26072544-26072566 CTCGGGGACAGGACTGAGAACGG + Intergenic
1106149359 13:27083501-27083523 CTGGGGAACTGTAATGAGAAAGG - Intronic
1106856086 13:33854620-33854642 CTGTGGCACAGGACTAAGAATGG + Intronic
1108179670 13:47828344-47828366 CTGGGATAAAGGACTGGAAATGG + Intergenic
1108223646 13:48265222-48265244 TTGGGGAATGGGACTGAGGAAGG - Exonic
1108287233 13:48920526-48920548 CTACAGAGAAGGACTGAGAAAGG + Intergenic
1109485042 13:63007607-63007629 CTTGGGGAAATGACTGAGAGTGG + Intergenic
1109918111 13:69018409-69018431 GTTGAGATAAGGACTGAGAAAGG - Intergenic
1111466662 13:88622353-88622375 CTCGGGAGAAGGACAGAGAAGGG + Intergenic
1111654919 13:91140389-91140411 TTGGGGAAAAGTAGTGTGAAAGG + Intergenic
1111697459 13:91642670-91642692 AAGGGGAAGAGGACTTAGAAAGG + Intronic
1111854933 13:93625701-93625723 CTTGGGAGAAAGACTTAGAAAGG + Intronic
1115404669 14:33001216-33001238 CTGGTGAAATGGACAGAAAATGG + Intronic
1115487160 14:33922285-33922307 CTGAGGAAATGTACTCAGAATGG - Intergenic
1115973666 14:38973627-38973649 CTGGGGGAAAGGGCAGAGACAGG - Intergenic
1116081021 14:40172400-40172422 TTGAGGAATAGGAATGAGAAAGG - Intergenic
1116239686 14:42324771-42324793 CAGAGGAAAAGGACTGGGGATGG + Intergenic
1116414780 14:44667021-44667043 CTGGAGAAGAGGCATGAGAATGG + Intergenic
1116505857 14:45680419-45680441 CTGGAGAAAAAGACAGAAAAAGG + Intergenic
1116581134 14:46642950-46642972 CTGGAGCAGAGGGCTGAGAATGG + Intergenic
1117001281 14:51374002-51374024 CTGGAGAACAGGAATGGGAATGG + Intergenic
1117810558 14:59541295-59541317 CTGGGGAAAAGTACTAACTAAGG + Intronic
1118988986 14:70781032-70781054 CTGGGGAAAAGCACAGAGGATGG - Intronic
1119217580 14:72880878-72880900 CTAGGGAATAGGCATGAGAAGGG + Intronic
1119621704 14:76136542-76136564 CTGGGGAGAGGGGCTGAGAAGGG + Intergenic
1119793581 14:77376504-77376526 CTGGGGCAGGGGACTGAGATGGG + Intronic
1121010041 14:90514423-90514445 CTGGGGAAATGGGGTGAGGATGG + Intergenic
1121095933 14:91218044-91218066 ATTGGGAAAAGCACAGAGAATGG - Intronic
1122445216 14:101762358-101762380 CGGGGGAAAGGGAGCGAGAAGGG + Intronic
1122730636 14:103794696-103794718 CTAGGTAAAAGGACTGAGAAAGG + Intronic
1122744441 14:103889591-103889613 CTGGGGCAAAGGGCTGAGATTGG + Intergenic
1122884031 14:104702645-104702667 CTGGGGAGACGGGCTGAGAATGG - Intronic
1125691886 15:41602355-41602377 CTAGTGAAAAGGCCAGAGAAGGG - Intergenic
1126750336 15:51870510-51870532 CTGGCCAAAATGATTGAGAAGGG - Intronic
1126767310 15:52022005-52022027 AGGGGGAAAAAGATTGAGAATGG + Intronic
1128176756 15:65562914-65562936 CTGGGCCAAACTACTGAGAAAGG - Intronic
1128861568 15:71078483-71078505 CTGGGGTACGGTACTGAGAAGGG - Intergenic
1129112006 15:73342642-73342664 CTGGGGAGAGGGACAGGGAAAGG - Intronic
1129671765 15:77611657-77611679 CAGGGGATAAAGCCTGAGAAAGG + Intergenic
1130106317 15:80931276-80931298 GAGGGGAAAAGGACACAGAATGG - Intronic
1130155558 15:81347164-81347186 CTGGGAAAATGAAGTGAGAAAGG + Intronic
1130514590 15:84616498-84616520 CTGGGTAAAAGCAATGAGGAAGG - Intronic
1130744018 15:86631180-86631202 CTTGGGACCAGGCCTGAGAAGGG + Intronic
1130889344 15:88120084-88120106 TTGGGGCATTGGACTGAGAAGGG - Intronic
1130895624 15:88168407-88168429 CTGGGGATCAGGGCTGGGAAAGG + Intronic
1131059726 15:89397299-89397321 ATGGGGAACAGGGCTGTGAATGG + Intergenic
1131273998 15:90965329-90965351 CTGGGAAGGAGGAGTGAGAAAGG + Intergenic
1131371698 15:91887264-91887286 CTGGGGAAAATGGCCGAGGAAGG - Intronic
1131449911 15:92530648-92530670 CTGGGGCAAAAGACCCAGAAAGG + Intergenic
1132106072 15:99063708-99063730 CTGTGGAAGAGGACTGGAAAGGG - Intergenic
1134451884 16:14368720-14368742 CAGGGGAGAAGGAATGGGAAGGG - Intergenic
1135939393 16:26808239-26808261 CTGGGGATAACGAATCAGAAAGG - Intergenic
1136014270 16:27385090-27385112 CTAGGGAAAGGAACTGAGAATGG + Intergenic
1137261810 16:46836749-46836771 ATGGGGAAATGTTCTGAGAAAGG - Intergenic
1138227831 16:55313536-55313558 CTTGGGAAAACAACTAAGAAGGG - Intergenic
1138344141 16:56309510-56309532 GTGGGGACAAGGACAGAGAAGGG + Intronic
1138482658 16:57314068-57314090 CTGAGGAAAGGGAATGAGAAGGG + Intergenic
1138670025 16:58606446-58606468 ATTAGGAAAAGTACTGAGAATGG - Intronic
1139648191 16:68347107-68347129 CTGGGCAAGTGGAGTGAGAAGGG + Intronic
1140107379 16:71973176-71973198 CTGGGCAAAAGGAGGGAGGAGGG - Intronic
1140514732 16:75533712-75533734 CTGTGTAAAAGGAGAGAGAAAGG + Intronic
1140817733 16:78636550-78636572 GTAAGCAAAAGGACTGAGAATGG - Intronic
1141963366 16:87424436-87424458 CTGGGGAAGAGCAGTGAAAAGGG + Intronic
1142482057 17:225190-225212 CTGGGGAGCAGGACAGAAAAAGG - Intronic
1143193766 17:5059713-5059735 CTGGGGAGAGGGAGGGAGAAAGG + Intergenic
1143638004 17:8177378-8177400 CTGGCTAAAAGCACTGAGATGGG - Intergenic
1143752425 17:9038301-9038323 ATGGGGAAAAGGAGTTAGTAGGG - Intronic
1144423688 17:15121117-15121139 CTGGAGAGAAGGAATGACAAGGG + Intergenic
1146253382 17:31371235-31371257 CTGAGTAAAGGCACTGAGAAGGG - Intronic
1147246232 17:39122921-39122943 ATTGGGAGAAGGACAGAGAAGGG + Intronic
1150893287 17:69179588-69179610 CTGGGGAAAAGAAAGGAGGAAGG + Intronic
1151539596 17:74758294-74758316 CTGGGGGAAAGGACAGATGAAGG + Intronic
1151970543 17:77455362-77455384 CGGGGGCACAGGCCTGAGAAGGG - Intronic
1153411276 18:4796434-4796456 CTGGGGTAAAGGCCTAAGAGTGG - Intergenic
1153726240 18:7958440-7958462 ATGGTGGAAAGAACTGAGAAGGG + Intronic
1153737663 18:8088726-8088748 CTGGGGAAAAAGGCGTAGAATGG - Intronic
1153737839 18:8090942-8090964 CTAGGGAAGAGGACTGGGAAAGG - Intronic
1153746590 18:8185907-8185929 CTGGGGAACAGGACTGTGTATGG - Intronic
1154064770 18:11096542-11096564 CTGCAGAAAAGAACTGGGAATGG - Intronic
1154068169 18:11128845-11128867 CTGGAGAACAGGCCTGGGAATGG + Intronic
1155028106 18:21960685-21960707 CCTGGGAAAAGGAGAGAGAATGG - Intergenic
1155345705 18:24854846-24854868 TGAGGGAAAAGGAGTGAGAAGGG - Intergenic
1156696919 18:39778586-39778608 CTGGGGAGAAGGAGATAGAAGGG + Intergenic
1156790990 18:40974667-40974689 CTGGGGAAAAAAACAGAAAAAGG - Intergenic
1156940038 18:42756003-42756025 CTCGGTAAAGGGACTAAGAAAGG + Intronic
1157598558 18:48878632-48878654 GTGGGGAACAATACTGAGAAAGG + Intergenic
1157804432 18:50647708-50647730 CTGTGGCAAAGGACAGAAAATGG - Intronic
1159067877 18:63589798-63589820 CTGGGGAAAAGGACTGAGAAAGG + Intronic
1159685115 18:71409615-71409637 CTGTGAAAAAGCAATGAGAATGG - Intergenic
1160073870 18:75653233-75653255 ATGGGGAAAAGGTGAGAGAAAGG - Intergenic
1162554859 19:11380621-11380643 CTGGGGAAAGGAACTAACAAAGG + Intronic
1164658921 19:29945438-29945460 CTGAGGAAGAGGACAGACAAGGG + Intronic
1164698607 19:30265570-30265592 CTGGGGAGACGCACTCAGAAAGG + Intronic
1164709506 19:30345269-30345291 CTGGGGACAGGAACAGAGAAAGG - Intronic
1165946553 19:39446410-39446432 CTGGAGAAAAGAACAGAAAAGGG + Intronic
1166325399 19:42047176-42047198 CTGGGGAAGGGGGCTGAGCATGG - Intronic
1166496122 19:43304504-43304526 CTGGAGAAAGGGACTGATAGGGG + Intergenic
1167051982 19:47084993-47085015 AAGGGAAAAAGGACTAAGAAGGG + Intronic
1167074578 19:47240673-47240695 CTGGGGAAAAGGGCTCAGAGGGG - Intergenic
1167427918 19:49439022-49439044 CAGGGGACAAGGACAGAGAAGGG + Intronic
1167708070 19:51093676-51093698 CTGGGACAAAGGTCTGGGAATGG - Intergenic
925740826 2:7004645-7004667 CTGGGGAAAAAGGCAGAAAAAGG - Intronic
925825843 2:7847686-7847708 CTGGAGAAAAGGCCTGAAAGAGG - Intergenic
926459276 2:13108985-13109007 CAGGGGAAAAGGTGGGAGAAGGG + Intergenic
927318868 2:21719797-21719819 GTGGGCAAAAGGACTGAATAGGG - Intergenic
927762471 2:25771693-25771715 CTGAGGAAAAAAACTGAAAAGGG - Intronic
927946687 2:27138908-27138930 CGGGGGATAAGGGCTGAGATGGG + Intronic
928721942 2:34131150-34131172 CTGGTGAAAAGGACCGAATATGG - Intergenic
928914986 2:36461025-36461047 CTGGGAAACAGAATTGAGAAAGG + Intronic
929060614 2:37920932-37920954 CTGCGGAAAACCACTGAGCAAGG + Intergenic
929769513 2:44879893-44879915 GTGGGGAGAAGGAGTTAGAAAGG - Intergenic
929918544 2:46155783-46155805 GTGGGGAGAAGGATGGAGAAAGG - Intronic
930102751 2:47615930-47615952 CTGGGGAAATGGATGAAGAAAGG - Intergenic
930263591 2:49174426-49174448 CAGGGGAAAGGTGCTGAGAATGG + Intergenic
930347705 2:50205940-50205962 CTTGGGAGAAGGAGAGAGAAGGG + Intronic
930489364 2:52048680-52048702 CTGAGGAAAAGAAGAGAGAAAGG + Intergenic
930674749 2:54188166-54188188 TGGGGGAAAAGGAGTGGGAAGGG + Intronic
932011417 2:67981530-67981552 GTGGGGCAAAGAACTGAGAGAGG - Intergenic
932068549 2:68592434-68592456 CAGGGGAAAAGCATAGAGAATGG + Intronic
932454784 2:71842487-71842509 TTGGGTAAAATGACTGAGCAGGG + Intergenic
932494603 2:72140168-72140190 CTTGGGAGAAGGACACAGAAAGG + Intronic
932891839 2:75604266-75604288 CTGGGGAAAAAAAGTGAGATGGG - Intergenic
934182822 2:89642728-89642750 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
934293114 2:91716917-91716939 CTGGAGAAAGGCACTGGGAAAGG - Intergenic
934737274 2:96695912-96695934 CTGGGGAAAGGCACGGAGGAAGG - Intergenic
935426627 2:102925722-102925744 CTGGGGAAAAAAAAGGAGAAAGG + Intergenic
935949836 2:108318678-108318700 CTAGGGAAAAGCAGTGACAAGGG - Intergenic
936396503 2:112135878-112135900 CTGAGGACAAAGACAGAGAAAGG + Intergenic
936941850 2:117891633-117891655 CTGGGGAAACGGGCTTAGACAGG + Intergenic
937316316 2:120934014-120934036 CTGGGGCCAGGGCCTGAGAATGG - Intronic
938611142 2:132948775-132948797 GTGGGGAAAAGGCAAGAGAAGGG - Intronic
938784122 2:134609910-134609932 CTGGTGAAAAGGGCACAGAAGGG + Intronic
939068791 2:137515566-137515588 CTGGAGAACAGGAATGGGAATGG + Intronic
939152894 2:138494145-138494167 CTGGGGGAAAAAAATGAGAAAGG + Intergenic
940066662 2:149637808-149637830 CTGGGCAGAAGCACTGACAATGG - Intergenic
940997444 2:160164999-160165021 CTGGGAACAAAGACTGAGGAGGG - Intronic
941334981 2:164230819-164230841 CTGGTGAAATGGACAGGGAATGG + Intergenic
943058746 2:183015948-183015970 CTGGGAAAAAGGCTTGAGAGGGG + Intronic
943945718 2:194060623-194060645 CTTGGGAGAAGGACATAGAAGGG - Intergenic
944595281 2:201255492-201255514 CTGAGGAGCAGTACTGAGAATGG - Intronic
944755501 2:202757332-202757354 TTGGGGACACGGACTGGGAACGG - Exonic
945801296 2:214434601-214434623 ATGAGGAAATGGGCTGAGAAAGG - Intronic
946153418 2:217791293-217791315 CTGGAGAAAGAGAATGAGAAAGG - Intergenic
946355581 2:219182391-219182413 CTGGGGAACAGGTGGGAGAATGG - Exonic
947533784 2:230928425-230928447 CTGGGGAAATGGGCTCAGAGAGG - Intronic
947942414 2:234069743-234069765 CGGGGGAGAAGGAGAGAGAATGG + Intronic
948108036 2:235430711-235430733 CCGGGGAAAAGTCCTGAGGAAGG - Intergenic
948833960 2:240615310-240615332 CAGGGGAAACAGACGGAGAAGGG - Intronic
1168862414 20:1055287-1055309 ATGGTGACAGGGACTGAGAAAGG - Intergenic
1168889112 20:1282517-1282539 CTTAGAAAAAGGCCTGAGAAGGG + Intronic
1168903189 20:1383184-1383206 CTGGGTAACAGGACTGAAGAAGG + Intronic
1168944989 20:1746062-1746084 CTGGGGAGAATGACTGCAAAGGG + Intergenic
1169418096 20:5434500-5434522 CTGAAGAAAAGGACTCAGAGAGG + Intergenic
1169802834 20:9529100-9529122 CTGGGGTAAATGCCTAAGAATGG + Intronic
1170717195 20:18842181-18842203 CTGGGGAAATGGTCTGGGAAGGG - Intergenic
1171062514 20:21979824-21979846 CTATGTAAAAGGACTGAGGAAGG + Intergenic
1172121258 20:32600185-32600207 CTGGAGAAAATGTCAGAGAAGGG + Intronic
1172275977 20:33679631-33679653 CTGGGGAAACGGGCTCAGAGAGG - Intronic
1172292132 20:33784120-33784142 ATGGGGAAGAGGAGGGAGAAGGG - Intronic
1172593211 20:36131995-36132017 CTGGGGAACAGGCCTGAGCTGGG - Intronic
1173598037 20:44272399-44272421 CTGGGGAAAGGATGTGAGAAGGG + Intronic
1173810396 20:45951853-45951875 CTGGGGAAAATGCCACAGAAGGG - Intronic
1173854002 20:46238052-46238074 CTGTGGAGAAGGGCTGAGGATGG - Intronic
1173878760 20:46394533-46394555 CTGGGGAGAAAGAATCAGAAAGG + Intronic
1173929586 20:46807569-46807591 CTGGGGGAAGGGACAGAGGAAGG + Intergenic
1174024716 20:47564177-47564199 TTGGGGAAAAAAACGGAGAAAGG - Intronic
1175489208 20:59367687-59367709 CTGGGGGAAAGGCCTGATTAGGG + Intergenic
1175607345 20:60321853-60321875 CTGGGGGAGAGGGCAGAGAATGG + Intergenic
1175733627 20:61370915-61370937 CGGGGGAAAGGGAGGGAGAAAGG - Intronic
1175921512 20:62452530-62452552 CTGAGGAGAAGGACTGAGGAGGG - Intergenic
1176000328 20:62828741-62828763 CTGGGGACAAGGGATGAGTAAGG - Intronic
1176204971 20:63883337-63883359 CTGGGGCCAAGGAGTGAGCAGGG + Intronic
1176665920 21:9687650-9687672 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
1176729658 21:10480553-10480575 TTGGAGAAAAGCACTGGGAAAGG + Intergenic
1176997858 21:15577933-15577955 CTGGAGAACAGGCATGAGAATGG + Intergenic
1177872068 21:26586188-26586210 AGGGGGAAAAGAACTCAGAAAGG - Intergenic
1178005962 21:28219804-28219826 TTGGGGAAGAGGAATGAGGATGG - Intergenic
1178670876 21:34590685-34590707 CTGGGGCCAGGGACTGAGAAAGG + Intronic
1179914640 21:44468148-44468170 CCAGGGACAAGGACTGGGAAGGG + Intergenic
1180834604 22:18923559-18923581 CTGGGGCAGAGGCCTGAGCAAGG - Intronic
1181020540 22:20099527-20099549 CTGGGGAGAAGGGCTGGGAATGG + Intronic
1181065285 22:20302952-20302974 CTGGGGCAGAGGCCTGAGCAAGG + Intergenic
1181711726 22:24695642-24695664 CTGGGGCAGAGGCCTGAGTAAGG - Intergenic
1181744389 22:24945717-24945739 CTGGGGACAAGCACAGAGGAAGG + Intronic
1181995927 22:26882471-26882493 ATGGAGAAAGGGAGTGAGAAGGG - Intergenic
1182017046 22:27049439-27049461 CTGAGGACTAGGGCTGAGAAGGG - Intergenic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182569146 22:31223124-31223146 CTGGGGTGAAGGACAGGGAAGGG + Intronic
1183124126 22:35759141-35759163 ATGGGGAAAAGGAGTGAAGATGG - Intronic
1183233731 22:36600034-36600056 CAAGAGGAAAGGACTGAGAAGGG - Intronic
1183592734 22:38789966-38789988 CTGGGGAAAAAGACTGGGGTTGG + Intronic
1183849234 22:40570111-40570133 CTGGGAAGAAGGAGTGAGAGAGG - Intronic
1184641003 22:45870056-45870078 CTGGAGAAAGAGACTGACAAAGG - Intergenic
1203284693 22_KI270734v1_random:148858-148880 CTGGGGCAGAGGCCTGAGCAAGG - Intergenic
950222483 3:11206853-11206875 CTGTGGAAAGGGACAGACAAGGG + Intronic
950300044 3:11868932-11868954 CTGAGGAATGGGACAGAGAATGG - Intergenic
950311332 3:11960959-11960981 GTGGGGGGAAGGACAGAGAACGG + Intergenic
950416814 3:12873507-12873529 GTGGGGAGCAGGCCTGAGAAGGG + Intergenic
950537730 3:13590097-13590119 ATGGGGTTAAGAACTGAGAAAGG - Intronic
950640781 3:14346810-14346832 TTGGGGAAAAGGGCTCAGAGAGG - Intergenic
951836026 3:26984296-26984318 TTGGGGAAAAGAAATAAGAATGG + Intergenic
953232308 3:41075922-41075944 CTGGGCAAAAGGCCTGTGACCGG + Intergenic
954489759 3:50892477-50892499 CTGGGAGAAGGGACTGACAAAGG - Intronic
955143997 3:56298174-56298196 CTGGGGAAAGGGAGGGAGATGGG - Intronic
955208328 3:56917638-56917660 ATGGGGACAAAGTCTGAGAAGGG + Intronic
955340300 3:58120276-58120298 CTTGGGGAAAGGAGTGACAAGGG - Intronic
955812864 3:62809439-62809461 CTGTGGAAAAGCTCTGAGAAAGG - Intronic
956358960 3:68425815-68425837 CTCAGGAACAGGTCTGAGAATGG - Intronic
956513890 3:70024855-70024877 CAGAGGAAAAGGAGTGAGAGAGG + Intergenic
956888782 3:73588531-73588553 GTGGGAAACAGGACTGAGGAGGG - Intronic
957040412 3:75331768-75331790 CTGGGGAGAAGGACAAAGGAGGG - Intergenic
957396915 3:79652316-79652338 GTGTGGAAGAGGTCTGAGAATGG - Intronic
957491842 3:80937479-80937501 CTAGGGAAGAGGATTGTGAATGG - Intergenic
957968230 3:87348981-87349003 GGGGGGAAAAGGAATCAGAACGG + Intergenic
958487591 3:94731845-94731867 TTGGGGAAGAGGTATGAGAATGG - Intergenic
958721009 3:97843443-97843465 GTGGGGAAAGGCTCTGAGAAGGG + Intronic
958925191 3:100149842-100149864 CTGGGACAAAGGGCTGAGATGGG - Intronic
959962415 3:112313775-112313797 TTGGAGAGAAGGACTGAGAGTGG + Intergenic
961119115 3:124358251-124358273 CTGGGAAAATGGACACAGAAAGG - Intronic
961756186 3:129128532-129128554 CTGTGGAAAAGGTCTGAGTGAGG - Intronic
962715849 3:138125549-138125571 CTGGGTGAAGGGACTGTGAAGGG + Intronic
963284157 3:143417119-143417141 CTAAGGAAAGGGAGTGAGAAGGG + Intronic
963496127 3:146063862-146063884 CTGGGCCAAAGGACTGAGAGAGG - Intergenic
963766084 3:149337306-149337328 CTGGTGAAAAGGAATGGAAAGGG + Intergenic
963961119 3:151310259-151310281 CTGGGGAGAAGGAGGCAGAAAGG + Intronic
965242774 3:166225119-166225141 GTGGGAAATAGGACTGGGAAGGG + Intergenic
966192315 3:177282474-177282496 CTAGGGAAAAGGACTGCTATAGG + Intergenic
966898250 3:184461817-184461839 CCGGGGAAGAGGGCAGAGAAAGG + Intronic
967505578 3:190249473-190249495 CTGGGGAACAGGCATGGGAATGG - Intergenic
968229319 3:196996055-196996077 CTGGGGAAGAGGAAAGAGCAGGG - Intronic
968808753 4:2790763-2790785 CTGGGGAAAGGGGCAGAGACCGG - Intergenic
969563388 4:7963436-7963458 CTGGGGAGAAGGGCTGAGGATGG + Intergenic
970132597 4:12887701-12887723 CTGGGGAAAGGAATAGAGAAAGG + Intergenic
970243396 4:14032802-14032824 CTGGGGAAAGGCAGTGAGCATGG - Intergenic
970794450 4:19894029-19894051 CTTGGGAATGGGCCTGAGAAGGG - Intergenic
971002839 4:22341551-22341573 CTGGAGAACAGGAATGGGAATGG + Intergenic
971036428 4:22697964-22697986 CTGGGGGAAAGAAATAAGAATGG - Intergenic
971100928 4:23465792-23465814 CTGGGGAAGAGGTATGTGAATGG - Intergenic
971670083 4:29545193-29545215 ATGGTGAGAAGGACAGAGAAAGG + Intergenic
971685256 4:29757289-29757311 CTGGAGAACAGGCATGAGAATGG + Intergenic
972852664 4:43070524-43070546 CTGGGGAATAGGGCTAAAAAGGG + Intergenic
972997612 4:44901165-44901187 CTGAAGAAAATGACAGAGAAGGG - Intergenic
973893965 4:55394471-55394493 TTGGGGAAAAGTTCTGAGAGTGG + Intergenic
974099863 4:57404837-57404859 GTGGAGAAAGGGAATGAGAAGGG + Intergenic
974611701 4:64226900-64226922 CTAGGGAGAAGGACAGAGAAAGG - Intergenic
975811378 4:78173528-78173550 CTTGGGAATGGGACTGGGAATGG - Intronic
976576166 4:86674023-86674045 CTGTGGAAAAGAACTGAAAATGG + Intronic
976815053 4:89138504-89138526 CAGGGTAAAAAGACTGAGAAAGG + Intergenic
977069699 4:92369331-92369353 CTGTGGAAAAAGACATAGAAAGG + Intronic
977204355 4:94153006-94153028 CTGGAGAATAGGTATGAGAATGG + Intergenic
977313167 4:95412243-95412265 GTGGTGAAGAGGATTGAGAAGGG - Intronic
978133537 4:105229686-105229708 CTGGAGAAAAGCACTGGGAGGGG - Intronic
978350740 4:107818246-107818268 CTGGGCATAAGCACAGAGAATGG - Intergenic
978655557 4:111061676-111061698 CTGGGGACAAAGAATGAGGATGG + Intergenic
978839520 4:113193488-113193510 ATGGGCGTAAGGACTGAGAAGGG + Intronic
979238960 4:118431675-118431697 CTGGAGAAAAGGACAGTGAATGG - Intergenic
979478850 4:121190550-121190572 CTGGGAAAAGGGGCTGACAAAGG + Intronic
979590328 4:122471783-122471805 CTGGGGAAAGGGAGAGAGACAGG - Intergenic
980060476 4:128123461-128123483 CTGGGTAAAGGGATAGAGAATGG - Intronic
982543819 4:156708879-156708901 CTAGGGAAAAGGCATGAGAATGG - Intergenic
983486226 4:168333954-168333976 CTGGGGAATTGGATTGAGGAAGG - Intergenic
984065100 4:175037922-175037944 CTCGGGAGAAGGACAGAGAAAGG + Intergenic
984991774 4:185387924-185387946 GTGGGGAAAAGGAGTTAGAGAGG - Intronic
985311105 4:188600418-188600440 CTGAGGAGAAGGACAGAGATGGG + Intergenic
985411650 4:189691909-189691931 CTGGGAAAAAGGAAAGACAAAGG - Intergenic
985731580 5:1552294-1552316 CTCGGGAGAGGGACTGAGAGGGG + Intergenic
986303222 5:6495056-6495078 CTGGGCAAAGGGAAGGAGAAGGG + Intergenic
986774976 5:11006154-11006176 TTGGCAAAAAAGACTGAGAAGGG + Intronic
986875444 5:12102008-12102030 TGTGGGAAAAGGACTGAAAAGGG + Intergenic
987313060 5:16699131-16699153 CAGGGGAGAAGGACTGATACTGG + Intronic
987620732 5:20336332-20336354 CTCAGGAGAAGGACAGAGAAAGG + Intronic
987960717 5:24804701-24804723 CTGAGTAAAAGGGCTAAGAAGGG + Intergenic
988267781 5:28973650-28973672 CTGGAGAACAGGCCTGGGAATGG - Intergenic
988594971 5:32582948-32582970 CTGGGAAGTAGGGCTGAGAAGGG - Intronic
988693008 5:33591653-33591675 AGAGGGAAAAGGACTGAGCATGG - Intronic
989144770 5:38238000-38238022 CTGGGGAAAGTGGTTGAGAAGGG - Intergenic
990787266 5:59435777-59435799 CTTGGGAAAGTAACTGAGAAGGG - Intronic
991960577 5:72039983-72040005 ATGAGGAAGATGACTGAGAAGGG - Intergenic
992703235 5:79361989-79362011 GCAGGGAAAAGGACTTAGAAAGG - Intergenic
992756309 5:79909897-79909919 CTGGGGAAAAGGCATGAGAAGGG - Intergenic
994438463 5:99769224-99769246 CTTGGGAGAAGGACAGAGAAGGG + Intergenic
994607086 5:101981691-101981713 CTGTGAAAAAGGACTGAGTGTGG + Intergenic
995131065 5:108631076-108631098 CTTGGGAAAGGGGCTGTGAAAGG - Intergenic
995150341 5:108836786-108836808 GAGGGGAAAAGGAGAGAGAAAGG - Intronic
995543872 5:113210518-113210540 ATTGAGAAAGGGACTGAGAATGG + Intronic
995873084 5:116762797-116762819 ATTGGGAAGAGGACTGAGAAAGG + Intergenic
995991151 5:118241163-118241185 CTGGGACAAAAGACTGAGACTGG - Intergenic
996447831 5:123577208-123577230 TTGGAGAAAAGGACTGATTATGG - Intronic
996632281 5:125648197-125648219 CTTGGGAAAAAGACTGGGAAGGG + Intergenic
998290248 5:140907924-140907946 TTGGGGAAAAGGTATGTGAATGG - Intronic
999675791 5:154001264-154001286 CAGAGTAAAAGGACAGAGAATGG + Intronic
999864479 5:155685599-155685621 AGGGGGAAAAAGACTGGGAAGGG - Intergenic
1000283048 5:159798857-159798879 CTTGGGAGAAGGAGGGAGAAGGG - Intergenic
1000303252 5:159973661-159973683 CTGGAAAAAAGCACTGAGGAAGG + Intergenic
1000662440 5:163952262-163952284 ATGGGGAAAAGCACTGAGGGAGG + Intergenic
1001056683 5:168455472-168455494 CTGGGGAGAAGGTCTTAGAGCGG - Exonic
1001124796 5:169009772-169009794 GGGCGGGAAAGGACTGAGAAAGG + Intronic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002561482 5:180085017-180085039 TTGGGGACAAAGACTGTGAAAGG - Intergenic
1002739208 5:181422273-181422295 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1002824653 6:761809-761831 CCGAGAAAAAGGACTTAGAAAGG + Intergenic
1003046354 6:2736714-2736736 CAGGGGAAAAGGACAGAAACTGG + Intronic
1003408991 6:5846799-5846821 CTGGGGAAACAGCCTGAGACAGG + Intergenic
1003968023 6:11271810-11271832 CTGGAGAAAATGGCTGAGATTGG - Intronic
1004061710 6:12204381-12204403 CGGGGGAAAGGGAGGGAGAAAGG - Intergenic
1005505446 6:26465311-26465333 CAGGGGAAAAGGAGTTTGAACGG + Exonic
1006147575 6:31968613-31968635 CTGAGGACAAGGGCTGAGATGGG - Intronic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006838186 6:37011807-37011829 CTGGGAGGAAGAACTGAGAATGG - Exonic
1007209860 6:40184520-40184542 CAGGGGGAAAGGAGTGGGAAAGG + Intergenic
1007308652 6:40927252-40927274 CTGGGGAAAGTGACTGAAGAGGG + Intergenic
1007385215 6:41516049-41516071 CTGGGGGCAAGGGCTGGGAAAGG + Intergenic
1007521818 6:42455879-42455901 ATGGGGATAAGTGCTGAGAATGG - Intergenic
1007694570 6:43724117-43724139 CTGGGGAGAAGGATTGGGATTGG + Intergenic
1007703316 6:43776724-43776746 CTGGGGAAGAGGACTGGCAGGGG + Intronic
1009566551 6:65318248-65318270 CTGGAAAAGAGGAGTGAGAAGGG - Intronic
1010466740 6:76176187-76176209 CAGAGAAAAAGGACAGAGAAAGG + Intergenic
1011603244 6:89079317-89079339 CTGGGGAAACAGGCTTAGAAAGG - Intergenic
1012247596 6:96943210-96943232 CTGGGGTAAAGGACTGTGATAGG + Intronic
1012945641 6:105463031-105463053 GTGAGGAAATTGACTGAGAAGGG - Intergenic
1013998667 6:116340008-116340030 CTGAGAAAAAGGATTGAGGAAGG + Intronic
1014491294 6:122065004-122065026 CTGGTGAATAGAACTGAAAAAGG - Intergenic
1017123548 6:151045705-151045727 CTGGGGAAAAGGACTCATGCTGG - Intronic
1017426324 6:154325399-154325421 CTGGGGAAGAGAACTAAGAGTGG + Intronic
1018021841 6:159768385-159768407 CTGGGGAGAAGGGCTGCAAAGGG + Intronic
1018235223 6:161717272-161717294 ACGGGCAAGAGGACTGAGAATGG + Intronic
1019244318 6:170697832-170697854 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1020392166 7:7669820-7669842 CTATAGAAAAGAACTGAGAATGG - Intronic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021324843 7:19254181-19254203 GTGAGGAAAATGGCTGAGAAAGG - Intergenic
1024316904 7:48028574-48028596 CTTGGGAGAAGGATTAAGAAAGG - Intronic
1026525512 7:71150109-71150131 ATGGTGAACAGGAATGAGAAGGG - Intronic
1026904726 7:74056453-74056475 CTGGGGACATGGGTTGAGAAGGG + Intronic
1028585444 7:92447481-92447503 CTGGGAAGCAGGACTGGGAAAGG - Exonic
1028674329 7:93441795-93441817 CTCCAGCAAAGGACTGAGAAAGG - Intronic
1029540727 7:101180478-101180500 CTGGGGAGTGGGACTGAGGATGG + Intergenic
1029647640 7:101868444-101868466 CTGGGGGAAAAGACTGAGACAGG - Intronic
1030273528 7:107695259-107695281 CTGGGGAAAAGCACAGACACAGG + Intronic
1031541022 7:122994574-122994596 CAGTGGAAAAGGATAGAGAAAGG + Intergenic
1031676656 7:124619138-124619160 CTGGGGAAAAAGGCTGAGTGGGG - Intergenic
1032306407 7:130736050-130736072 TTGGGGAAAAGGGTGGAGAATGG - Intergenic
1032527463 7:132590224-132590246 CTGAGGAAATGAACTGAGGAAGG + Intronic
1032557631 7:132853872-132853894 CTGGGGAGTAGGACAGGGAAGGG + Intronic
1032655903 7:133929269-133929291 CTGGGGCACAAGACTGAGACTGG + Intronic
1033112502 7:138593702-138593724 CTAAGGAAAAGGAGAGAGAAGGG + Intergenic
1034451280 7:151138538-151138560 CTGGGGAAAAGGGCTGCACATGG - Intronic
1035261420 7:157663828-157663850 TTAAGGTAAAGGACTGAGAATGG - Intronic
1035503807 8:110340-110362 CTAGAGAAAAGGACAGTGAATGG + Intergenic
1036076533 8:5508360-5508382 ATGGGGAAGAGGTCTGATAAAGG - Intergenic
1036220031 8:6913806-6913828 CTGAGGCAAAGGCCAGAGAAAGG + Intergenic
1038209564 8:25503464-25503486 CTCGGGAATAGGACTGAGGAGGG - Exonic
1038477624 8:27879295-27879317 CTGGGACACAGGACTGGGAAGGG + Intronic
1038732345 8:30138776-30138798 TTGGGGAGAATGACTTAGAACGG + Intronic
1040949985 8:52928505-52928527 CTTGGGAAAAGGGATGGGAAGGG - Intergenic
1041691870 8:60695017-60695039 CGGGGAAAATGGACTGAGAGAGG + Intronic
1042220816 8:66472236-66472258 CTGGGGAGTAGGTATGAGAAAGG + Intronic
1042313709 8:67402939-67402961 CTCGGGGAAAGGGCTGGGAATGG - Intergenic
1042399826 8:68332012-68332034 CAGGAGAAAGGGACGGAGAAAGG + Intronic
1042614645 8:70634954-70634976 TTGGGGAACAGGGGTGAGAAGGG - Intronic
1042879285 8:73469508-73469530 CTGAGTAGAAGGACTGAGTAAGG + Intronic
1042978486 8:74498817-74498839 GTGGGGAGCAGGACAGAGAAAGG - Intergenic
1043944763 8:86237524-86237546 CTGAGGAAAAGGAAAGAGACAGG + Intronic
1044633063 8:94297774-94297796 CTGGGGAAGAGGTATGTGAATGG - Intergenic
1044820721 8:96154147-96154169 TTGGGGAGAAGGACAGAGGACGG - Intronic
1045737422 8:105313060-105313082 CTGTGGAAGAGGATTGGGAATGG + Intronic
1046093250 8:109527972-109527994 ATGGGGTAAGGTACTGAGAATGG + Intronic
1046761388 8:118025065-118025087 CTGAGGAAAGAAACTGAGAAAGG + Intronic
1047304187 8:123639918-123639940 CAGGGGACAAGGACTGTGACTGG - Intergenic
1047632671 8:126725452-126725474 CTGGAGAAGAGGCATGAGAATGG - Intergenic
1048084181 8:131159446-131159468 CTGGAGAACAGGCATGAGAAAGG - Intergenic
1048288916 8:133164714-133164736 CTGTGGAGAAGGACAGTGAATGG - Intergenic
1048441041 8:134459107-134459129 CTGGGGACAAGGACTCTGCAGGG - Intergenic
1049240856 8:141536802-141536824 CTGGGGACAAAGCCTGACAAAGG - Intergenic
1049370944 8:142266638-142266660 CTGTGGAACAGCACAGAGAAAGG - Intronic
1049695901 8:143984158-143984180 CTGGGGCAGAGGCGTGAGAAAGG + Intronic
1049838688 8:144755966-144755988 CGGGAGAAAAGAACTGAGACTGG - Intronic
1050606014 9:7301917-7301939 TTGGGAACAAGGACTGATAAAGG + Intergenic
1051475744 9:17507130-17507152 GTGGGGAAAAGGAGGGAGAGAGG - Intergenic
1052917232 9:33932754-33932776 GTGGGGATAAGGAATGAGGATGG - Intronic
1053414623 9:37939272-37939294 CTGGAGCAAATGGCTGAGAAGGG + Intronic
1054145660 9:61559284-61559306 TGGGGGAAAGGGTCTGAGAAGGG + Intergenic
1054465399 9:65490388-65490410 TGGGGGAAAGGGTCTGAGAAGGG + Intergenic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1057075875 9:92137935-92137957 CTGGGCGCAGGGACTGAGAAGGG - Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058033908 9:100230056-100230078 CTGGGGTACAGGAATGAGCACGG - Intronic
1058213758 9:102205975-102205997 ATGTGGAAAAGGAATGAGATTGG - Intergenic
1058383475 9:104405964-104405986 CTGGGGAAAAGAACTGAGCTAGG - Intergenic
1058954164 9:109930186-109930208 TTGGGGAGAAGGAATGAGAAAGG - Intronic
1059286100 9:113172928-113172950 CTGGGCAAAGGCACTGAGATAGG - Intronic
1059838206 9:118181222-118181244 GTGGGGAAGAGGAGGGAGAAAGG - Intergenic
1060024536 9:120160170-120160192 GTGGGGCAAAGTAATGAGAAAGG + Intergenic
1060055970 9:120413385-120413407 TTGGGGAGCAGGCCTGAGAAAGG - Intronic
1060227379 9:121801809-121801831 CAGGGGAAAATTACTGAAAAAGG - Intergenic
1060251027 9:121986818-121986840 CTTGGGACAAGAAGTGAGAACGG - Intronic
1060587564 9:124795939-124795961 CTGGGGACAAGGACAGAGTTGGG + Intronic
1060771941 9:126338182-126338204 CTGGGGGGAAGGAGGGAGAACGG + Intronic
1060839512 9:126782655-126782677 TGAGGGAAAAGGAGTGAGAATGG + Intergenic
1060876579 9:127088210-127088232 ATGGTGAAAAGTCCTGAGAATGG + Exonic
1061150323 9:128824448-128824470 CTGGGGAACAGGGCAGAGACTGG + Intronic
1061201010 9:129138586-129138608 GTCGGGAAAGGGACTGAGGAGGG - Intronic
1062453000 9:136623348-136623370 CTGGAGAGAAGGAAGGAGAAAGG - Intergenic
1062541704 9:137044487-137044509 CTGGGGAAAAGGGCTAGGAGGGG - Intronic
1203604506 Un_KI270748v1:47058-47080 CTAGAGAAAAGGACAGTGAATGG - Intergenic
1203660178 Un_KI270753v1:34111-34133 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1203670946 Un_KI270755v1:11073-11095 CTGGGAAAAAGGAAAGACAAAGG + Intergenic
1185892961 X:3836427-3836449 CTGGGGAGAGGGACTGGGACTGG - Intronic
1185898070 X:3874847-3874869 CTGGGGAGAGGGACTGGGACTGG - Intergenic
1185903189 X:3913278-3913300 CTGGGGAGAGGGACTGGGACTGG - Intergenic
1186561568 X:10618918-10618940 ATGAGGAAAAGGAAGGAGAAGGG - Intronic
1187268477 X:17759069-17759091 ATGGGGAAAAAGAATGAAAAAGG - Intergenic
1187766312 X:22646525-22646547 ATGGAGAAAAGAACTCAGAAGGG - Intergenic
1187831708 X:23389075-23389097 CTGGGGAATGGGACAGAGAATGG - Intronic
1188260555 X:28017762-28017784 CTGGGGAAAAGGACAGCGATGGG + Intergenic
1189068941 X:37844338-37844360 CTGGGGAATGGGACTGGGGATGG - Intronic
1189752928 X:44241114-44241136 CTGGGGAGAAGCAGTGATAAAGG - Intronic
1190062575 X:47220563-47220585 CTGCGGAATAGGGCTGAGTAAGG + Intronic
1190301195 X:49058611-49058633 CTGGGAAGAAGGGCTGAGAGTGG - Intronic
1190880826 X:54491494-54491516 CTGGGGAAAGGGCCTTAGATGGG + Intronic
1190912849 X:54788447-54788469 CTGGGGAAGAGGAGAGAGGATGG - Intronic
1190918105 X:54824923-54824945 CTGGGGAAGAGGAGAGAGGATGG + Intergenic
1192661857 X:73050059-73050081 CTGGAGAAAAGGCATGGGAATGG - Intergenic
1193832650 X:86307818-86307840 CTGGAGAACAGGAATGGGAATGG + Intronic
1194032294 X:88832157-88832179 CTGGAGAACAGGCATGAGAATGG - Intergenic
1195782672 X:108482171-108482193 CTGGAGAACAGGCATGAGAATGG - Intronic
1197393663 X:125898769-125898791 CTGGGGAAAGGAAAAGAGAAAGG - Intergenic
1197497762 X:127207273-127207295 CTGGAGAACAGGCCTGGGAATGG - Intergenic
1198573271 X:137981526-137981548 GTGGGGAAACTGACTGAGAGTGG - Intergenic
1198748421 X:139914221-139914243 CTGGGAAAATGGACTGAGAGAGG - Intronic
1199275772 X:145940174-145940196 CTGGGGAACAGGCATGGGAATGG + Intergenic
1199627374 X:149752896-149752918 CTGGAGAACAGGCATGAGAATGG - Intergenic
1199955681 X:152740551-152740573 TTGGGGAAGAGGATGGAGAAGGG - Intergenic
1200222912 X:154400645-154400667 CTGGGGCAAAGGTGGGAGAAGGG - Intronic
1200645753 Y:5781358-5781380 AGGGGGAAAAGGAGAGAGAAAGG - Intergenic
1202386715 Y:24333471-24333493 CTGGAGAAAAGGACAGTGAATGG - Intergenic
1202484070 Y:25336657-25336679 CTGGAGAAAAGGACAGTGAATGG + Intergenic