ID: 1159069220

View in Genome Browser
Species Human (GRCh38)
Location 18:63604907-63604929
Sequence CTGGTCAGAAGCAGAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159069220_1159069227 13 Left 1159069220 18:63604907-63604929 CCAGCTCTTCTGCTTCTGACCAG No data
Right 1159069227 18:63604943-63604965 CCCTTCTCAGTCTATTAAAAAGG No data
1159069220_1159069230 18 Left 1159069220 18:63604907-63604929 CCAGCTCTTCTGCTTCTGACCAG No data
Right 1159069230 18:63604948-63604970 CTCAGTCTATTAAAAAGGGCAGG No data
1159069220_1159069229 14 Left 1159069220 18:63604907-63604929 CCAGCTCTTCTGCTTCTGACCAG No data
Right 1159069229 18:63604944-63604966 CCTTCTCAGTCTATTAAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159069220 Original CRISPR CTGGTCAGAAGCAGAAGAGC TGG (reversed) Intergenic
No off target data available for this crispr