ID: 1159075749

View in Genome Browser
Species Human (GRCh38)
Location 18:63679904-63679926
Sequence GTTTTTGTCAGGAACTCGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159075749_1159075757 16 Left 1159075749 18:63679904-63679926 CCCCCCGAGTTCCTGACAAAAAC 0: 1
1: 0
2: 0
3: 4
4: 107
Right 1159075757 18:63679943-63679965 CGAAGAGCATTTCCTCAGCCTGG 0: 1
1: 0
2: 0
3: 8
4: 140

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159075749 Original CRISPR GTTTTTGTCAGGAACTCGGG GGG (reversed) Intronic
900419419 1:2549284-2549306 CTTTATGTCTGGAAGTCGGGGGG - Intergenic
900475435 1:2874263-2874285 GTCTGTGCCAGGAACTAGGGAGG + Intergenic
902343771 1:15801039-15801061 GGTTTTGTCAGGACCGCAGGAGG + Intergenic
902461479 1:16580638-16580660 GTTTTAGTCAGAAACTAGGATGG - Intronic
903646355 1:24898428-24898450 ATTTGAGTCAGGAACTCTGGAGG + Intergenic
903917615 1:26775566-26775588 GTTTATTTCAGGAACCCCGGAGG + Exonic
905313906 1:37068983-37069005 CTTTTTGTCAGGCAGTCGGGTGG + Intergenic
911208463 1:95116807-95116829 GTGTTTTTCAGGAATTCTGGAGG + Intergenic
913603204 1:120441580-120441602 GTTTTAGTCAGAAACTAGGATGG + Intergenic
913603951 1:120447932-120447954 GTTTTAGTCAGAAACTAGGATGG + Intergenic
913640819 1:120810649-120810671 GTTTTAGTCAGAAACTGGGATGG + Intronic
914277658 1:146139696-146139718 GTTTTAGTCAGAAACTAGGATGG - Intronic
914364383 1:146965195-146965217 GTTTTAGTCAGAAACTAGGATGG + Intronic
914365150 1:146971485-146971507 GTTTTAGTCAGAAACTAGGATGG + Intronic
914487298 1:148121942-148121964 GTTTTAGTCAGAAACTAGGATGG - Intronic
914538704 1:148590644-148590666 GTTTTAGTCAGAAACTAGGATGG - Intronic
914587642 1:149077095-149077117 GTTTTAGTCAGAAACTAGGATGG - Intronic
915812256 1:158926132-158926154 GTTTTTGTCAGAAACATTGGAGG - Intergenic
918239276 1:182607627-182607649 GTTTTTGTCATGAACCAGTGGGG - Intergenic
919721665 1:200843661-200843683 ATTTTTGTAAGTAACTCTGGAGG - Intronic
919903439 1:202060792-202060814 CTTTTTGTCAGGAATTCTGGTGG + Intergenic
1063899424 10:10717005-10717027 GTTTTTATCAGGGACTCAGTGGG + Intergenic
1064359942 10:14655539-14655561 GTTTGTGCCAGCTACTCGGGAGG - Intronic
1065736822 10:28760815-28760837 ATTTTTGTCAGGAACTCTCATGG + Intergenic
1066683171 10:37955263-37955285 TTTTTTGTCAGGAACTAGTCTGG - Intronic
1067916312 10:50403028-50403050 GTCTTTGGCAGCAACTTGGGTGG - Intronic
1071010494 10:80934798-80934820 GTTTTTTGCAGGAACATGGGTGG + Intergenic
1072221300 10:93329871-93329893 GTTTTTGTGAGGTACTCAGATGG - Intronic
1074443981 10:113503232-113503254 CTTTTTGTCAGAAACTCAGAGGG - Intergenic
1080700849 11:34642885-34642907 GCTTTTGTCTGGAACGCTGGGGG - Intronic
1082862195 11:57867456-57867478 GTTCTGGTCAGGAACTCAGCAGG + Intergenic
1106360488 13:29026449-29026471 GTTCTTGTCAGGCACTTTGGGGG - Exonic
1107429967 13:40331857-40331879 CTTTGTGGCAGGAACTGGGGAGG - Intergenic
1113487442 13:110664697-110664719 GATTTTGACAGGAATTTGGGAGG - Intronic
1117156841 14:52950688-52950710 GCTTTCGGCAGAAACTCGGGAGG + Intronic
1128777863 15:70337459-70337481 GTTTTTATCAGGAAGGCTGGCGG + Intergenic
1134334262 16:13282338-13282360 CTTTTTGTCAGAAACAAGGGAGG - Intergenic
1135260247 16:20974377-20974399 GTCTTGGTCAGCTACTCGGGAGG + Intronic
1136499227 16:30661464-30661486 GTTTTTGGGAGGAACGGGGGTGG + Intronic
1144388516 17:14771900-14771922 CTTTTTCTCAGGAACTCAGAAGG - Intergenic
1146377506 17:32304424-32304446 GCTTTGGTCAAGAACACGGGTGG + Intronic
1147766749 17:42841973-42841995 GTGTTTTTTAGGAACTAGGGTGG + Exonic
1149261943 17:54889665-54889687 GTTTTTGTAAGGAACATGGTTGG + Intergenic
1152377306 17:79925480-79925502 GGTTTTCTCAGGAGCCCGGGTGG + Intergenic
1152736914 17:82001566-82001588 GTTTTGGTGAGGAACCCCGGGGG + Intronic
1159075749 18:63679904-63679926 GTTTTTGTCAGGAACTCGGGGGG - Intronic
1160492278 18:79348430-79348452 GTTTGTGTCAGGAACTGTGTTGG + Intronic
1160615704 18:80125687-80125709 GGTAGTGTCAGGTACTCGGGAGG + Intronic
1161515143 19:4692349-4692371 GTGTCTGTCAGGAGCACGGGAGG + Intronic
1166998420 19:46730862-46730884 GTCTTTGGCAGGAACGCGGCAGG - Exonic
1167675780 19:50884337-50884359 GTGTTTGTCAAGAACTCTGAGGG + Intergenic
1202677917 1_KI270711v1_random:24385-24407 GTTTTAGTCAGAAACTAGGATGG - Intergenic
926905778 2:17804392-17804414 TTTTCTGTCACCAACTCGGGAGG - Intergenic
929546412 2:42857634-42857656 GTTTGTGTCGGGGACTAGGGAGG - Intergenic
929579471 2:43072483-43072505 ATGTTTATCAGGAACTTGGGTGG + Intergenic
931547296 2:63403112-63403134 GTTTTTTGCAGGAACTTGGACGG + Intronic
934109224 2:88726196-88726218 GCTTTGGTCAGGTACTGGGGTGG + Intronic
939608029 2:144275804-144275826 GTTTTTATCAGAATCTCAGGTGG - Intronic
940051522 2:149470088-149470110 GTTTTTGTCACTAACTCTGTGGG + Intronic
942242631 2:173977095-173977117 GTGTTTGTGAGGAACTCTGTGGG - Intergenic
942361452 2:175176662-175176684 GTAGTTATCAGGAACTAGGGAGG - Exonic
945319840 2:208408493-208408515 CTTTTTGTAAGGAAATGGGGAGG + Intronic
945376711 2:209085134-209085156 GTGGTTGTCAGGAACTGGGCAGG - Intergenic
948524430 2:238561582-238561604 TTTTTTGTCAGCTACTTGGGAGG + Intergenic
1170467086 20:16631886-16631908 CATTTTTTCAGGAACTAGGGAGG + Intergenic
1172986801 20:38997983-38998005 GTTTCTCTCAGGGACTGGGGTGG + Intronic
1179611117 21:42551427-42551449 GTGGTTGTCAGGGACTAGGGTGG + Intronic
1183024340 22:35052870-35052892 GTTTTTGTCAGGATGTAGGCTGG - Intergenic
949714614 3:6914946-6914968 ATTTTTGACAGGAACTCAAGAGG + Intronic
950624717 3:14236600-14236622 ACTATTGTCAGGTACTCGGGAGG + Intergenic
955364560 3:58299956-58299978 GTTTCGGGCAGGAACTCTGGGGG - Intergenic
961392937 3:126567170-126567192 GAGTTTGTCAGGAGCTGGGGAGG + Intergenic
966176678 3:177145899-177145921 GTTTTTATCAGGAAGTCTGATGG + Intronic
967871696 3:194235054-194235076 TTTTTTTTCAGGAATGCGGGTGG + Intergenic
971594568 4:28512442-28512464 CTTTTTTTCAGCTACTCGGGAGG - Intergenic
979614841 4:122731347-122731369 GTTTTTGTCAGGAAATAATGAGG - Intergenic
983631750 4:169856564-169856586 CATGTTGTCAGGACCTCGGGAGG - Intergenic
984149446 4:176108397-176108419 GTTGTTGCCAGGAATTGGGGAGG + Intronic
987644708 5:20653699-20653721 GTTCTTGGCAGGAACACGGATGG + Intergenic
990705230 5:58521061-58521083 GTTTTTTGCAGGAACATGGGTGG + Intergenic
993970001 5:94407667-94407689 GTGGTTGTCAGGAACTGGGGAGG + Intronic
994187819 5:96835311-96835333 GTTCTTGTCAGGAACTTGACAGG - Intronic
994188057 5:96837744-96837766 GTTCTTGTCTGGCATTCGGGAGG + Intronic
997296409 5:132771629-132771651 GTTTGTGCCAGGAACATGGGTGG - Intronic
997969818 5:138391934-138391956 GTCTTTGGCAGGCACTCAGGCGG + Exonic
999733460 5:154493566-154493588 CTCTTTGTCAGGTCCTCGGGCGG - Intergenic
1000751927 5:165106849-165106871 CTATTTGTCAGAAACTCGGTGGG + Intergenic
1001163737 5:169344640-169344662 GTGTTTGTCAAGAAGTTGGGAGG - Intergenic
1002905758 6:1447744-1447766 GTTTTTTGCAGCAACTTGGGTGG - Intergenic
1006443380 6:34065625-34065647 GTGTTTGTCAGGAGCCTGGGCGG - Intronic
1007355224 6:41310212-41310234 GTTGTTGTCAAGAACCCTGGAGG - Intergenic
1007748638 6:44058537-44058559 GTTTCTGGCAGGAACTCCTGAGG + Intergenic
1008064751 6:47035732-47035754 TTGTTTGTAAGGAACTCAGGTGG - Intronic
1012208691 6:96493992-96494014 GTTTTTTTCAGGAACCTGGATGG + Intergenic
1021722645 7:23518804-23518826 GTAGTTCCCAGGAACTCGGGAGG - Intronic
1022832642 7:34083971-34083993 GTTTTTGTCAGGATCACAAGAGG + Intronic
1035143791 7:156792092-156792114 GATTTTGTAAGGAACTCTGGAGG - Intronic
1035821348 8:2595499-2595521 GTTATTGTCAAGAACTCTGAAGG + Intergenic
1037619115 8:20547645-20547667 GTGTTTGCCAGGGACTGGGGAGG + Intergenic
1040400893 8:47048291-47048313 GTTTTTTTCAGAAACTAGGATGG - Intergenic
1040796183 8:51292056-51292078 GTTTTTTGCAGGAACAGGGGTGG + Intergenic
1042783435 8:72519260-72519282 TTTTTTCTCAGCTACTCGGGAGG + Intergenic
1047263785 8:123286430-123286452 GTCTCTGGCAGGAACTAGGGTGG + Intergenic
1047813878 8:128441381-128441403 GTTTTTTTCAGGAACATGGTTGG + Intergenic
1051559119 9:18420549-18420571 GCCTTTGTGAGGAACTAGGGTGG + Intergenic
1062553723 9:137104139-137104161 GTGTTTTTCAGGGACTGGGGAGG - Intronic
1186900287 X:14047530-14047552 GTTTATATCAGAAACTGGGGAGG - Intergenic
1188686139 X:33072897-33072919 GTTTTAGTCAGTAAATCAGGAGG - Intronic
1192007071 X:67227508-67227530 GGAGTTGTCAGGAACTGGGGAGG + Intergenic
1193008264 X:76645130-76645152 GTCTTTCTCAGGAACCTGGGAGG + Intergenic
1196969160 X:121090018-121090040 GTATTTGTCAAGAACTGGGAAGG - Intergenic
1201298825 Y:12488704-12488726 GTGTTTGTCAGGGGCTGGGGAGG - Intergenic