ID: 1159080104

View in Genome Browser
Species Human (GRCh38)
Location 18:63726940-63726962
Sequence ACTAGGTGGAAGGCAGGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159080104_1159080113 21 Left 1159080104 18:63726940-63726962 CCAAGTCCTGCCTTCCACCTAGT No data
Right 1159080113 18:63726984-63727006 CACTGGTTTTGTGTGGCCAGTGG No data
1159080104_1159080111 14 Left 1159080104 18:63726940-63726962 CCAAGTCCTGCCTTCCACCTAGT No data
Right 1159080111 18:63726977-63726999 AAGCTACCACTGGTTTTGTGTGG No data
1159080104_1159080110 4 Left 1159080104 18:63726940-63726962 CCAAGTCCTGCCTTCCACCTAGT No data
Right 1159080110 18:63726967-63726989 TATGGTTTTGAAGCTACCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159080104 Original CRISPR ACTAGGTGGAAGGCAGGACT TGG (reversed) Intergenic
No off target data available for this crispr