ID: 1159081483

View in Genome Browser
Species Human (GRCh38)
Location 18:63740480-63740502
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159081479_1159081483 -6 Left 1159081479 18:63740463-63740485 CCATGGTGCCTTTTCTCTCTGAG No data
Right 1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159081483 Original CRISPR TCTGAGATTCAGACTGTGGT GGG Intergenic
No off target data available for this crispr