ID: 1159082199

View in Genome Browser
Species Human (GRCh38)
Location 18:63747751-63747773
Sequence ATATATGTGAATATACACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159082199_1159082200 -1 Left 1159082199 18:63747751-63747773 CCTATGTGTATATTCACATATAT No data
Right 1159082200 18:63747773-63747795 TCTAAATTTGTATTTTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159082199 Original CRISPR ATATATGTGAATATACACAT AGG (reversed) Intergenic
No off target data available for this crispr