ID: 1159082199 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 18:63747751-63747773 |
| Sequence | ATATATGTGAATATACACAT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1159082199_1159082200 | -1 | Left | 1159082199 | 18:63747751-63747773 | CCTATGTGTATATTCACATATAT | No data | ||
| Right | 1159082200 | 18:63747773-63747795 | TCTAAATTTGTATTTTAGAAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1159082199 | Original CRISPR | ATATATGTGAATATACACAT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||