ID: 1159084047

View in Genome Browser
Species Human (GRCh38)
Location 18:63767411-63767433
Sequence AAATATCAACAGATTGATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 329
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 309}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159084047_1159084049 21 Left 1159084047 18:63767411-63767433 CCCAGATCAATCTGTTGATATTT 0: 1
1: 0
2: 1
3: 18
4: 309
Right 1159084049 18:63767455-63767477 TCCATCTACACATTCTGTCCAGG 0: 1
1: 0
2: 1
3: 11
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159084047 Original CRISPR AAATATCAACAGATTGATCT GGG (reversed) Intronic
905104484 1:35556516-35556538 AAAAATGAACAGATTGTTCTGGG + Intronic
905735512 1:40323002-40323024 AAATATTAACAGATTGGGCTGGG + Intergenic
906163293 1:43667355-43667377 AAATTTCAACAGAGAAATCTCGG - Intronic
906443954 1:45877144-45877166 AAATGCCAACACCTTGATCTTGG - Intronic
908024190 1:59931410-59931432 AAATATCAACTCAATGATTTGGG - Intergenic
909353203 1:74677681-74677703 AAATATCAACACATGAATTTTGG - Intergenic
909731887 1:78902045-78902067 AAATTTTAATAGATTGCTCTGGG + Intronic
910984155 1:92989349-92989371 AAATATGAAAAGAAAGATCTGGG - Intergenic
911768586 1:101710280-101710302 AAATAAAAACAGAGTGATATAGG - Intergenic
911778709 1:101847423-101847445 TAATATCTACAGATTTCTCTGGG + Intronic
912051348 1:105532379-105532401 AAACATCAAGAGTTTGGTCTAGG + Intergenic
912185381 1:107268890-107268912 ATTTATCAACAGATATATCTAGG + Intronic
912944900 1:114076662-114076684 AAATAACACCAGGTTCATCTAGG + Intergenic
913146573 1:115996185-115996207 AATTATCTGCAGATTCATCTAGG + Intronic
913404293 1:118472188-118472210 ACAAATCAACACATTGATTTAGG + Intergenic
916316420 1:163453294-163453316 AAAAATCAGGAGATTGATCCAGG + Intergenic
916922394 1:169482689-169482711 AGATATCAACAGATATATATGGG + Intronic
918057773 1:181037108-181037130 TAATATCAAGAGACTGACCTTGG - Intronic
918725885 1:187923196-187923218 AAATATCAACTGATTTGTGTAGG - Intergenic
918906917 1:190508067-190508089 GAATATAAACACATTGATATTGG + Intergenic
919120244 1:193330838-193330860 AAATAAAATCAGATTGATATAGG - Intergenic
919588108 1:199464362-199464384 GAATATCTATAGATTTATCTAGG - Intergenic
921073700 1:211683329-211683351 AGGTCTCAACAGATTGGTCTAGG + Intergenic
921402532 1:214741658-214741680 AAATGTTAACAGATTGAACATGG - Intergenic
921493452 1:215807270-215807292 AAATATCAAAAGTTTGAAATGGG - Intronic
921562420 1:216674817-216674839 AAAGTTCAAGAGATTAATCTGGG - Intronic
922521964 1:226261035-226261057 AAATATGATCAGATTGATAGAGG + Intronic
923137788 1:231133670-231133692 AGATGTCAACAGATGCATCTGGG - Intergenic
1063428805 10:5970543-5970565 AACTATTCACAGATTTATCTTGG - Intronic
1064461220 10:15536225-15536247 AACAAAAAACAGATTGATCTAGG - Intronic
1064749228 10:18509502-18509524 AAATTTCAAAAAATTGTTCTCGG + Intronic
1065701572 10:28430901-28430923 AAATAGCAACACATTCATCCAGG + Intergenic
1068104241 10:52593270-52593292 AAATACAAACCGATTGATATAGG - Intergenic
1070017710 10:72550537-72550559 GAATATCAACCTATTGCTCTTGG + Intronic
1072354888 10:94598791-94598813 AAATATCAACACCTTGAATTAGG - Intronic
1072596850 10:96880834-96880856 AAATATCAACTGTTACATCTTGG - Intronic
1073127312 10:101159394-101159416 AAATACTAACAGAATGGTCTTGG + Intergenic
1075250454 10:120865901-120865923 TAACATCAAGAGATTAATCTTGG - Intronic
1078169958 11:8922210-8922232 AAATATTAAGAAATTGAACTGGG + Intronic
1078945904 11:16068470-16068492 CAATGTCAACAAAATGATCTAGG + Intronic
1079160477 11:17988197-17988219 AAATATCTAAAGATTGAGGTAGG - Intronic
1079937980 11:26641609-26641631 AAATATCTACATAATTATCTAGG - Intronic
1080524733 11:33103781-33103803 AAATATGTACAGATTCATCTGGG + Intronic
1080674586 11:34412955-34412977 AACTATTAAAAGATTGTTCTGGG + Intergenic
1080711902 11:34756663-34756685 AAAGATCAAGAGAATCATCTTGG - Intergenic
1080761617 11:35255545-35255567 AAATTTCAAAAGAGTGATCAAGG + Exonic
1081004694 11:37720629-37720651 AAATATCAGAAGAGTGATATGGG - Intergenic
1084798188 11:71523339-71523361 AGATATCAGCACCTTGATCTTGG - Intronic
1084987900 11:72893301-72893323 AAATGTTAAAAGAATGATCTAGG - Intronic
1085480426 11:76818454-76818476 AACTATAAACAAAATGATCTTGG - Intergenic
1087629437 11:100633334-100633356 AAATATCAACACACTTATCCGGG - Intergenic
1087860893 11:103154095-103154117 ATAAATCTACAGATTGATCTGGG - Intronic
1091571977 12:1694947-1694969 AAATAACAACATATTGATATGGG - Intronic
1093362025 12:18240922-18240944 AAATATCAACAAATTGAAAAAGG - Intronic
1095076497 12:37934180-37934202 AAATATCTTCAGATAGATATTGG - Intergenic
1097727239 12:63089051-63089073 AAATATCAAGATCTTGATCCTGG - Intergenic
1098214959 12:68206005-68206027 AGATATCAAGATATGGATCTTGG - Intronic
1099355686 12:81632276-81632298 AAATATTTACAGAATGATTTGGG - Intronic
1100433819 12:94553713-94553735 AGATATCAACAGTTGCATCTGGG + Intergenic
1101073584 12:101102796-101102818 AAATATCTTCAAATTGATGTAGG - Intronic
1101457613 12:104853130-104853152 AATTATCAGCAGGTTAATCTAGG + Intronic
1104318260 12:127724261-127724283 AAATATTAAGAGAAAGATCTTGG - Intergenic
1107258396 13:38459535-38459557 AAATATCTACATATTCATATGGG + Intergenic
1108507221 13:51123344-51123366 TCATCTCAACAGATTGATCATGG + Intergenic
1108725552 13:53176553-53176575 AAATATCAACATATGAATTTTGG + Intergenic
1108917335 13:55631077-55631099 AGCTATCAACAGAATGATCTAGG - Intergenic
1109428815 13:62205073-62205095 AAATACCAGGAGTTTGATCTAGG + Intergenic
1109448613 13:62479224-62479246 AAATTTCATGACATTGATCTTGG + Intergenic
1109622709 13:64930056-64930078 ATATGTCAACAGTTTGATCTTGG - Intergenic
1109973033 13:69795253-69795275 AAATATACACAGATTGATGGGGG - Intronic
1110184933 13:72662334-72662356 CAATATCAACAGATAGAACCTGG - Intergenic
1112731039 13:102362555-102362577 CAATATGAACAGAATGATATGGG + Intronic
1113036036 13:106050216-106050238 TGATATCAACAGATTGATGATGG - Intergenic
1115418180 14:33161176-33161198 AAATATTAAAAAATTAATCTGGG - Intronic
1116538114 14:46061821-46061843 AACTACCAACACCTTGATCTTGG - Intergenic
1117306949 14:54487092-54487114 AAATATTAATATATAGATCTGGG + Intronic
1117496818 14:56313693-56313715 AACTCTCAACAGAGTGTTCTAGG - Intergenic
1117669475 14:58092124-58092146 AAAAATGAACAGATTGAGGTGGG - Intronic
1117789769 14:59327956-59327978 AAATATTAACAAATTGAAGTTGG + Intronic
1118024962 14:61759744-61759766 AAGTTTCAACACATTGATTTTGG - Intergenic
1119011436 14:70993933-70993955 ATAAATCAACAGATAAATCTTGG - Intronic
1120447589 14:84619651-84619673 AAGTTTTAACAGATTCATCTTGG - Intergenic
1120752117 14:88207472-88207494 AAAGATAAACAGAGTGACCTTGG - Intronic
1121877346 14:97465409-97465431 ACTTATCAACAGTGTGATCTTGG + Intergenic
1125292838 15:38168669-38168691 AAATAGAAACAGATTGTTCAGGG + Intergenic
1126157485 15:45578828-45578850 AAATATGAACACATTCATATAGG - Intergenic
1127187376 15:56493514-56493536 AGATGTCAACACCTTGATCTTGG - Intergenic
1128507157 15:68281588-68281610 AAATATCAATGGCTTAATCTAGG - Intronic
1129563695 15:76597991-76598013 AACTATCAACAGAGTGAACAGGG + Intronic
1130247365 15:82263699-82263721 AAATATCAACAAATTAACTTTGG + Intronic
1130453281 15:84079260-84079282 AAATATCAACAAATTAACTTTGG - Intergenic
1131219933 15:90574844-90574866 AGATATGAACAGATTGTTCACGG - Intronic
1131363357 15:91815719-91815741 AAATATAAACAGAATCATCCAGG - Intergenic
1131654954 15:94446360-94446382 AAATGTCAACTGATTGCTGTTGG - Intronic
1133439168 16:5806293-5806315 AAATGCCAACACCTTGATCTTGG - Intergenic
1133910188 16:10058940-10058962 AAGAATCAACAGAGTGATATGGG + Intronic
1134910066 16:18017730-18017752 ATATATCATCAAATTTATCTTGG + Intergenic
1135578580 16:23605752-23605774 AGGTTTCAACAGATTAATCTTGG - Intronic
1135835096 16:25818177-25818199 AAATTTCAACATATGGATTTTGG - Intronic
1137781958 16:51104975-51104997 AAATATCAAGTCATTGATCATGG + Intergenic
1137891624 16:52169096-52169118 AATTATCAACATAGAGATCTTGG + Intergenic
1138176715 16:54906592-54906614 AAGTATCAAGACATTGGTCTTGG + Intergenic
1138949999 16:61900834-61900856 AAATATCAACAGGATTAGCTTGG + Intronic
1139145448 16:64318892-64318914 AAATATAAACATATTAATCCAGG - Intergenic
1139145849 16:64324298-64324320 AAATATAATCAAATTGATCATGG - Intergenic
1141780866 16:86159866-86159888 AAATATCCATAGCTTGAGCTAGG - Intergenic
1142913489 17:3114571-3114593 CAATATCAAGATATTGATGTGGG - Intergenic
1143738496 17:8932864-8932886 AAATATGAACCCATAGATCTGGG + Intronic
1144015420 17:11190653-11190675 AAATATCAACATATTGCTTTAGG - Intergenic
1149236491 17:54596415-54596437 AAAAAACAACAGATTTATATGGG + Intergenic
1150608818 17:66716640-66716662 AATTATCAACAGACAAATCTGGG + Intronic
1153486024 18:5599115-5599137 AAAAATCAAATGATTTATCTAGG - Intronic
1155837218 18:30600979-30601001 AAATATCAACAGACAAACCTGGG - Intergenic
1157137595 18:45071989-45072011 AAAAATCAAAACATTGATATTGG + Intergenic
1157541506 18:48514048-48514070 AATTGTCTACAGCTTGATCTGGG - Intergenic
1158089440 18:53693728-53693750 AAATAACCACAGACTGAACTTGG - Intergenic
1158400376 18:57116345-57116367 AAGTTTCAACAGATGGATTTGGG + Intergenic
1159084047 18:63767411-63767433 AAATATCAACAGATTGATCTGGG - Intronic
1159537916 18:69738314-69738336 AAATATTAACATATTGATATTGG + Intronic
1164103475 19:22080759-22080781 AAATATCAACAAATTGAAGCAGG - Intronic
925539133 2:4947892-4947914 ATATAACAACTAATTGATCTAGG + Intergenic
926576842 2:14592056-14592078 AGATTTCAACAGATTAATTTGGG - Intergenic
928154394 2:28863031-28863053 AACTGTAAACTGATTGATCTGGG - Intronic
928589286 2:32797519-32797541 AAATTTCAACAAATTGTCCTGGG + Intronic
928849827 2:35732397-35732419 TGCTATAAACAGATTGATCTAGG + Intergenic
929774706 2:44921846-44921868 AAATTTCAACATATTAATCTGGG + Intergenic
930299559 2:49597632-49597654 AAATGTCAACTCCTTGATCTTGG + Intergenic
930629417 2:53736021-53736043 AAAAATCTACAAACTGATCTTGG + Intronic
931047560 2:58373456-58373478 AAATATCAAGGGAGTGGTCTAGG + Intergenic
931290488 2:60868980-60869002 AAATGTCAGCACCTTGATCTTGG - Intergenic
931685204 2:64786450-64786472 ACTTATCAACTGATTGACCTTGG + Intergenic
933461787 2:82597188-82597210 AAATATAGAAAGATTTATCTAGG - Intergenic
933769184 2:85732473-85732495 AAATAATAACAGATTGTTATTGG - Intergenic
935066980 2:99657862-99657884 TGTTATCAACAGAGTGATCTGGG + Intronic
936467692 2:112767783-112767805 AAATATCATGGGTTTGATCTAGG + Intergenic
936925525 2:117732580-117732602 AAATATTAACATATTTCTCTAGG - Intergenic
938388750 2:130887596-130887618 AAACCTCAAAAGATTGATCAAGG - Intronic
939530912 2:143360425-143360447 AAATATCAAAAGATTATTCTAGG + Intronic
939701463 2:145397647-145397669 AAGGATCATCAGATTGATCCAGG + Intergenic
940015264 2:149097854-149097876 AAACATCAACAGATTTTTTTGGG + Intronic
940592086 2:155742339-155742361 AAAAATCTACACATTGGTCTTGG - Intergenic
941636289 2:167938730-167938752 AGAAATCATCAGATGGATCTAGG + Intergenic
942722936 2:178972813-178972835 AAATATCAACCCATTAATCCTGG + Intronic
942809651 2:179982870-179982892 AAACACAAACAGAATGATCTGGG - Intronic
942988240 2:182166719-182166741 AAATATCATCAGATTAGTCAAGG - Intronic
943036429 2:182751538-182751560 AATTATGAACAAATTGATTTTGG - Intronic
943218627 2:185074519-185074541 AAATATGAAAAGACTTATCTAGG - Intergenic
943971643 2:194416096-194416118 AAATAGTAATAGATTGATGTAGG + Intergenic
944383790 2:199141662-199141684 AAATGTGTACAGATTGATCCAGG - Intergenic
944470552 2:200048264-200048286 AAATATCAACAGATTTGACTGGG + Intergenic
944659082 2:201905412-201905434 ACATAGCAACAGAGTGCTCTGGG - Intergenic
945956487 2:216091169-216091191 AAATTTCAACATATGGATTTGGG - Intronic
946544254 2:220719298-220719320 AGAAATAAACAGATTGATCCAGG + Intergenic
946560216 2:220904384-220904406 AAATAGCAATAGATTATTCTTGG - Intergenic
947091388 2:226515599-226515621 AAATATAAACAGGTTTCTCTAGG + Intergenic
948313440 2:237008028-237008050 AAACATCAAAAGAGTGCTCTAGG + Intergenic
1169067112 20:2700274-2700296 AAATACCAACAGTGTTATCTGGG - Intronic
1169493274 20:6089505-6089527 AAATGTCACCAGATTCATGTCGG - Intronic
1169687499 20:8291570-8291592 AAATATCAACAAATAAATCATGG - Intronic
1170169689 20:13396707-13396729 AAATATCAACAGAATGAGAAAGG + Intronic
1173407140 20:42776274-42776296 ATATATCAAAAGATAAATCTGGG - Intronic
1176957237 21:15119613-15119635 AAATATCAACAGAGATTTCTCGG + Intergenic
1177170310 21:17647877-17647899 AGAGCTCAACAGATTTATCTAGG - Intergenic
1177346625 21:19881443-19881465 ACATATCAACATTTTGATATTGG - Intergenic
1177776759 21:25576576-25576598 AAATGTTAAGAGATTTATCTAGG + Intergenic
1177793407 21:25745790-25745812 AAATATCAACTGATAGGTCCTGG + Intronic
1178249080 21:30984986-30985008 AAATATCAACAGAGTGGGGTTGG - Intergenic
1182848169 22:33448615-33448637 AAAAAACAAGAGTTTGATCTGGG - Intronic
1184429890 22:44436249-44436271 AAATGGCACCAGATTGATCAGGG - Intergenic
949213756 3:1538771-1538793 AAATCTGGAAAGATTGATCTTGG + Intergenic
950418388 3:12882342-12882364 AAATCTCAACAGTTTCATTTGGG + Intergenic
950564242 3:13756763-13756785 AAATCCCAACAGATTTATTTGGG - Intergenic
952876670 3:37950758-37950780 GAATTTCAACAGATACATCTAGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
956038351 3:65119869-65119891 AAATAAAAACAGATTGAGTTGGG + Intergenic
957125880 3:76159611-76159633 ACATATGAACAGTTTGGTCTAGG + Intronic
957151610 3:76493452-76493474 AAATATTAAAAGATTGCTTTAGG + Intronic
957495990 3:80992069-80992091 AAAGAGCAAGAGATTGAACTGGG + Intergenic
957542776 3:81596180-81596202 AAATATCAGGAAATGGATCTAGG + Intronic
958146039 3:89626239-89626261 AAAGATCAAGAGATTGGTCCTGG + Intergenic
959300626 3:104596127-104596149 AAAAGTAAACAGATTGAACTAGG - Intergenic
959411081 3:106022395-106022417 CAATATCAATATATTCATCTTGG + Intergenic
959991461 3:112636844-112636866 AAAGATCAATAAATTGATGTTGG - Intronic
960235195 3:115273778-115273800 AAAAAGCAACAGATAGATGTTGG - Intergenic
960452863 3:117831840-117831862 AAAAGTCAACACATTGAGCTGGG + Intergenic
960871357 3:122253013-122253035 AAAGATCAACAGCTGGATATAGG - Intronic
962359792 3:134728789-134728811 AAATATTAACAGATTTATCTTGG + Intronic
962786441 3:138772616-138772638 AAAAATCAAAAGAATGATGTGGG - Intronic
964153237 3:153553875-153553897 AAATATCAACAGACTTTTTTGGG + Intergenic
964305173 3:155332062-155332084 AAATATCAACAGAATGGTACTGG - Intergenic
964326618 3:155553471-155553493 AAATATCCAGAAAGTGATCTAGG + Intronic
964663601 3:159148938-159148960 TAACATCAACAGTATGATCTGGG + Intronic
965816289 3:172640261-172640283 AAATCTCAATAGATTCATTTTGG + Intronic
965843353 3:172932912-172932934 AAATATACAAAAATTGATCTTGG - Intronic
966163959 3:176996185-176996207 AAATCTCAACTGAATGATTTGGG - Intergenic
966797256 3:183727455-183727477 GAATACCTACAGATTGATTTGGG - Intronic
967257281 3:187606722-187606744 AAATATCATACGATTTATCTTGG + Intergenic
967326576 3:188246420-188246442 AAATATCAAAACACTGAGCTTGG - Intronic
969259274 4:6023317-6023339 AAATATGAACAAACTGATGTCGG - Intergenic
971057370 4:22928723-22928745 AAATAACAAGAGATTGGACTGGG - Intergenic
971258607 4:25035576-25035598 AAGTATTAAGAGATTGGTCTTGG + Intergenic
971750540 4:30641452-30641474 AAATATCTATAGATTGTTCTGGG + Intergenic
971779314 4:31010966-31010988 ATATTTCAACAGATTTATCGGGG - Intronic
972255921 4:37355258-37355280 AAATATCAGCATTTTGATTTTGG - Intronic
973849568 4:54947788-54947810 CAATACCAACAGCTTGATCTTGG + Intergenic
974217400 4:58867830-58867852 AAATATCCATAGATTGCTCAAGG + Intergenic
975086740 4:70350443-70350465 GAATATTCACAGATTGGTCTAGG - Intergenic
975182201 4:71359087-71359109 AATTAGGAACAGATGGATCTTGG + Intronic
976806227 4:89050557-89050579 AAAAATCAAGAAATTAATCTTGG + Intronic
977483162 4:97605457-97605479 AAATATGAATAGATAGATTTGGG + Intronic
978339812 4:107710384-107710406 AAATAACAAAAGAATGATATGGG - Intronic
978734396 4:112068714-112068736 AAATATCTCAAGGTTGATCTTGG + Intergenic
981641324 4:146946444-146946466 AAATATCATCGTATTAATCTCGG + Intergenic
982023111 4:151224007-151224029 GAATATCAAAAGTATGATCTAGG + Intronic
982360917 4:154518205-154518227 AAACAGGGACAGATTGATCTGGG - Intergenic
982819210 4:159925757-159925779 AAATATATACAGATTGGTTTTGG - Intergenic
983267241 4:165521028-165521050 AAATATCAACATATGAATTTGGG - Intergenic
986798301 5:11233636-11233658 AATTACTAACAGTTTGATCTTGG + Intronic
987175208 5:15300975-15300997 AAATATGAACAAATTCTTCTTGG + Intergenic
988017018 5:25572305-25572327 ACATATCAACTGCTTCATCTGGG - Intergenic
988230386 5:28470638-28470660 ACATATCGACAAATTCATCTTGG - Intergenic
989596970 5:43165271-43165293 AGAAACCAGCAGATTGATCTTGG - Intronic
990426018 5:55689945-55689967 CAATTAGAACAGATTGATCTAGG + Intronic
991695178 5:69264549-69264571 TAAAATTAACAGATTGATCCAGG + Intronic
992358014 5:76005632-76005654 CAATAACAGCATATTGATCTAGG - Intergenic
992579384 5:78156002-78156024 ATATATCAACAGCTAGATGTTGG - Intronic
992770902 5:80046953-80046975 AAATTTCATCTGATTGATTTTGG - Intronic
992851564 5:80814760-80814782 GGATATCAACAAAATGATCTTGG - Intronic
993066893 5:83112288-83112310 TAATATCATCCGATTGAGCTTGG - Intronic
993159935 5:84277167-84277189 AAATTTCAACATATGAATCTTGG - Intronic
993430122 5:87822704-87822726 AAATATCAACAAAATTAGCTGGG - Intergenic
993670512 5:90755523-90755545 AAAAATAACCAGATTGATTTGGG - Intronic
993880014 5:93350778-93350800 CAATGTCTACAGATTCATCTGGG - Intergenic
994282382 5:97921191-97921213 AACTGTCAGCAGTTTGATCTTGG + Intergenic
994792091 5:104241383-104241405 AAACATCAACTGCTTGATGTTGG - Intergenic
994885193 5:105551233-105551255 CACTGTCAACAGCTTGATCTTGG + Intergenic
998180081 5:139930879-139930901 AAGAATCCACAGATTTATCTGGG + Intronic
998661061 5:144238200-144238222 AAATATCAACATGTTGACTTTGG + Intronic
998707771 5:144783502-144783524 AAATATGACCAGTTTCATCTGGG + Intergenic
999136777 5:149325754-149325776 AGATGTCAACACCTTGATCTTGG - Intronic
999518913 5:152330339-152330361 AAATCTCTAGAGATGGATCTCGG + Intergenic
999916303 5:156266119-156266141 ACATATAAAAAGCTTGATCTTGG + Intronic
1000073982 5:157767704-157767726 AAGTATCAACAGCTTCATCAAGG + Intergenic
1001151242 5:169229321-169229343 AACTCTCAACAGATTAATGTGGG + Intronic
1001829759 5:174775888-174775910 AAATATCTAAAGATAGATATAGG - Intergenic
1004249883 6:14015159-14015181 AGATATCAACACCTTGATCTTGG - Intergenic
1004742129 6:18472329-18472351 TTATATCAACACATTGATTTTGG + Intergenic
1004810931 6:19261716-19261738 AAATACCAAAAGATTGATAATGG + Intergenic
1006326861 6:33360793-33360815 TAATATCCTCAGATTGATCTGGG + Intergenic
1007140078 6:39563461-39563483 ATGTATCTACATATTGATCTGGG - Intronic
1009625515 6:66135647-66135669 AAATATACACAGACTGGTCTAGG - Intergenic
1009958735 6:70492393-70492415 AAATATAAACAATCTGATCTTGG + Intronic
1010227103 6:73500614-73500636 AAATCTCAGCAGATTGATGATGG - Exonic
1010446345 6:75952982-75953004 AAATATCCACAAACAGATCTGGG + Intronic
1011450604 6:87488080-87488102 AGATATCAACAGTTTGATTTTGG + Exonic
1014334746 6:120119521-120119543 AATTATCAAGAGGTTGATCCTGG + Intergenic
1015389417 6:132664380-132664402 ATATACCAACACCTTGATCTTGG + Intergenic
1015968743 6:138722101-138722123 AAATACCCACAGATGGATATTGG - Intergenic
1016079872 6:139843093-139843115 CACTATCAAAAGAATGATCTGGG - Intergenic
1016615410 6:146042166-146042188 AAATTTCAACACATGGATTTTGG + Intronic
1020104899 7:5418230-5418252 AAATATTCACAGCCTGATCTGGG - Intronic
1020745032 7:12069676-12069698 GAATATGAGCTGATTGATCTTGG - Intergenic
1022029065 7:26475616-26475638 AAATTTCATCAGAGTGATTTTGG + Intergenic
1022157825 7:27678055-27678077 AATTATCAAAAGCTTGAGCTTGG - Intergenic
1022377124 7:29824584-29824606 AAATGTCAACAGTGTGATGTGGG + Intronic
1024370163 7:48573825-48573847 TAATGGCAACAGCTTGATCTCGG - Intronic
1024656168 7:51452920-51452942 AAATTTCAACAGACTCAGCTGGG - Intergenic
1027448501 7:78302574-78302596 GAATATAAACAGCTTCATCTGGG + Intronic
1027774942 7:82453221-82453243 AAATATCACTTGATTGATGTGGG + Intergenic
1028099647 7:86804329-86804351 AAATATTAGCAGATGAATCTTGG - Intronic
1028621225 7:92831833-92831855 AAATATCTACAGAATCTTCTTGG - Intronic
1028655526 7:93201824-93201846 AAAGAACAACAAAATGATCTTGG - Intronic
1029187025 7:98746698-98746720 GAATTTCAACATATGGATCTAGG + Intergenic
1030234273 7:107242080-107242102 AAATGTCAAAAGATCAATCTAGG - Intronic
1030338684 7:108352659-108352681 AAATATCAACAGAATAATGGTGG + Intronic
1030545592 7:110891185-110891207 AAATATCAGCAGTTAGAACTAGG + Intronic
1030978027 7:116151536-116151558 AAATTTCAACAGCTAGGTCTGGG - Intronic
1032009215 7:128331222-128331244 AAATTTCTACATCTTGATCTGGG + Intronic
1033137977 7:138800558-138800580 AACCATCAACACCTTGATCTTGG - Intronic
1034572005 7:151963834-151963856 AAATATCAAAACATTGATGTTGG - Intronic
1035088785 7:156286695-156286717 AAATATTAACAGAAAGATTTGGG + Intergenic
1037338380 8:17814088-17814110 AAACACCATCAGATAGATCTTGG + Intergenic
1038157968 8:25008837-25008859 AATTATCAACAGCTTTATCATGG + Intergenic
1040921588 8:52626523-52626545 AAATGTTAACAGATGAATCTGGG + Intronic
1041705799 8:60844987-60845009 GAATATCAAAAGCTTCATCTGGG + Exonic
1042589169 8:70379083-70379105 AAACATTAAGAGATTTATCTTGG - Intronic
1043389583 8:79779503-79779525 AAATGTCAACAAAGTGCTCTTGG - Intergenic
1044267413 8:90199630-90199652 AAATATCAACATTTAGATCAGGG - Intergenic
1045184371 8:99821771-99821793 AAATATCCACAAATTGTACTTGG + Intronic
1047551900 8:125883184-125883206 AAATTTCAACATATGGATTTTGG - Intergenic
1049520256 8:143084486-143084508 AAAAATCGACAGATTGGGCTTGG - Intergenic
1051091577 9:13416029-13416051 AAATAGCAACGCTTTGATCTTGG + Intergenic
1052011059 9:23409772-23409794 AAATATAAACAGATACATATTGG + Intergenic
1052252481 9:26415215-26415237 ATATGTCAACAGTTTGTTCTTGG + Intergenic
1052612595 9:30795165-30795187 AAATATCAACTTAATGACCTTGG - Intergenic
1055362912 9:75513485-75513507 AAATCTCTACAAATTGATATGGG - Intergenic
1055684624 9:78758079-78758101 ATATTTTAACAGATTGATGTGGG + Intergenic
1057105944 9:92417155-92417177 AAATCTCAAAAGATTGATTATGG - Exonic
1058035063 9:100242794-100242816 AAATAAAAACAGAGTGAACTAGG - Intronic
1058078570 9:100676228-100676250 ACAAATGAACAGATGGATCTGGG + Intergenic
1058228473 9:102396087-102396109 GAATATCAACCAAATGATCTAGG + Intergenic
1058365094 9:104200257-104200279 AACTAGCAACAGAAAGATCTGGG - Intergenic
1058794821 9:108487972-108487994 AAATTTCAACACATGGATTTGGG + Intergenic
1059570760 9:115432286-115432308 ACTTATCATAAGATTGATCTTGG - Intergenic
1060960712 9:127678738-127678760 ACATAACAACAAATAGATCTGGG - Intronic
1185469159 X:372324-372346 AAATATCAACAGAAAGAAGTGGG + Intronic
1185973512 X:4692136-4692158 AAATTTCAAGAGATTGCTTTTGG - Intergenic
1187569573 X:20487292-20487314 AAAAACCAAAAGATTGATTTAGG - Intergenic
1187968571 X:24637328-24637350 AAATATTAACTGATTAAGCTGGG - Intronic
1188487267 X:30696241-30696263 AAATATCAACAGTTAAATTTTGG - Intronic
1191019565 X:55844704-55844726 AACTATCATCAGATTGAACAGGG + Intergenic
1192187598 X:68962139-68962161 AAATATTAACAAATTGAATTCGG - Intergenic
1192590096 X:72352328-72352350 AAGTACCAACAGAATGCTCTTGG - Intronic
1193916650 X:87372752-87372774 AAATGGCAACAGATCGATCAAGG + Intergenic
1194131759 X:90090370-90090392 ACATATCAACTGCTTCATCTGGG - Intergenic
1194395242 X:93375393-93375415 ACATACCAAAAGACTGATCTAGG + Intergenic
1194416842 X:93624047-93624069 AACTGTCAACAGAATTATCTAGG + Intergenic
1194823932 X:98538731-98538753 AACTCTCAAGACATTGATCTGGG + Intergenic
1196090309 X:111733809-111733831 AAATATCAAAAAATAGATGTTGG - Intronic
1196559586 X:117129265-117129287 TAATTTCAACATATTGATATTGG - Intergenic
1197179322 X:123517425-123517447 AAATATCAAAGGTTTGGTCTAGG + Intergenic
1197657450 X:129132478-129132500 AAATATCAGCAGTTTGGTTTCGG + Intergenic
1198002767 X:132456439-132456461 AATAATCAATAGATTGACCTTGG - Intronic
1198682918 X:139202299-139202321 ATGTAGCACCAGATTGATCTAGG - Intronic
1198915612 X:141668181-141668203 AAATAGAAACAGATTGTACTAGG - Intronic
1199302314 X:146227545-146227567 AAATATCATCAAATTGATTGTGG + Intergenic
1199567668 X:149232482-149232504 AAATATCAACAACTTCCTCTGGG - Intergenic
1201523256 Y:14901326-14901348 AAATACAAACAGAATGATTTCGG + Intergenic
1201710234 Y:16983807-16983829 ATATATCAACATATTCATATTGG + Intergenic