ID: 1159084076

View in Genome Browser
Species Human (GRCh38)
Location 18:63767841-63767863
Sequence TGATAGGTATAGAACTATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 183}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159084076 Original CRISPR TGATAGGTATAGAACTATTC AGG Intronic
903964746 1:27080177-27080199 AACTAGTTATAGAACTATTCAGG + Intergenic
904846100 1:33418556-33418578 TAATAGCTATAGGGCTATTCAGG - Intronic
905496386 1:38391673-38391695 TAATAATTATAGAACTATTTGGG - Intergenic
905534676 1:38711838-38711860 TAATAGATATAGGACTATTCAGG - Intergenic
907792613 1:57682130-57682152 TGGAAGGGATAGAAATATTCAGG + Intronic
909553109 1:76921640-76921662 TAATGGTTATAGAACTATTCTGG - Intronic
909921793 1:81390609-81390631 GGATAGGTATGGAAAAATTCTGG - Intronic
910137181 1:83985875-83985897 TAGTAGTTATAGAACTATTTAGG - Intronic
911182523 1:94873984-94874006 TGACTGGTTTAGAGCTATTCTGG + Intronic
913031290 1:114905753-114905775 TTATTGTTATAGAACTATGCAGG + Intronic
918854316 1:189730798-189730820 TGATATGTATTTAAGTATTCAGG + Intergenic
919437571 1:197581052-197581074 TTATAGGTCTAGAATTATTCAGG - Intronic
920642356 1:207764774-207764796 TGGTAGATATAGGAGTATTCAGG - Intronic
922021805 1:221712858-221712880 TGAAAGTTATTGAAGTATTCTGG + Intronic
923477785 1:234352547-234352569 TAATAGATATAGTGCTATTCAGG - Intergenic
1064388018 10:14915597-14915619 TAATAGGCACAGGACTATTCAGG - Intronic
1065592151 10:27274753-27274775 TGATAGTTATGGCACTATACAGG + Intergenic
1066080156 10:31922625-31922647 TAATAGATATAGGAGTATTCAGG - Intronic
1067027195 10:42854096-42854118 TAATGGTTATAGGACTATTCAGG + Intergenic
1068815589 10:61307194-61307216 TGGCAGATATAGGACTATTCAGG + Intergenic
1068833345 10:61522886-61522908 TGATACATACAGAACTATTCAGG + Intergenic
1070118437 10:73551808-73551830 AGATTTGTATAGAACTATCCTGG - Intronic
1070463603 10:76694658-76694680 AAATAGGTATAGACCTATTTGGG - Intergenic
1071106370 10:82101017-82101039 TAGTAGATATAGAACTCTTCAGG + Intronic
1074806277 10:117056038-117056060 TGATGGTTATAGGACTATTCAGG - Intronic
1074879394 10:117642216-117642238 TAATAGATATAGGACTATTCAGG + Intergenic
1075986619 10:126792553-126792575 TGAAAGATATAGGGCTATTCAGG - Intergenic
1076939846 10:133596155-133596177 TGATAGCTATAGGACTATTCAGG + Intergenic
1077825448 11:5804085-5804107 TGTTGGGTATAAAAATATTCTGG + Intronic
1077951688 11:6966085-6966107 TAAGAGGTATAGAGCTATTCAGG + Intronic
1078504560 11:11924630-11924652 TAATAGATATAGGACTTTTCAGG + Intronic
1079148089 11:17872436-17872458 TGATAGGTAAGCAACTACTCAGG - Intronic
1079372366 11:19862567-19862589 TCCTAGGTATGGAAATATTCGGG - Intronic
1081473032 11:43394489-43394511 TGAGAGGACTTGAACTATTCAGG + Intronic
1086000713 11:81982058-81982080 AAATAGATATAGGACTATTCAGG + Intergenic
1086152043 11:83622355-83622377 TCATAGGCATAGAGCTATGCTGG + Intronic
1087333081 11:96807999-96808021 TAATAGATATAGACCTATTCAGG + Intergenic
1088323823 11:108581955-108581977 TGATAGATATAGAACTTTTTCGG - Intronic
1088726397 11:112640296-112640318 CAATAGATATAGAGCTATTCAGG + Intergenic
1091200252 11:133773881-133773903 TGATAGGTATATGGCTATTCAGG - Intergenic
1091713245 12:2757519-2757541 TAATAGGTACAGGACTATTCAGG + Intergenic
1093532219 12:20180114-20180136 TAATAGATATAGCACTATTAAGG + Intergenic
1095510335 12:42944331-42944353 TGATATTTATAGAACACTTCAGG - Intergenic
1095681692 12:44984871-44984893 TGATAGATATAGAACTGTTTAGG + Intergenic
1096438169 12:51613284-51613306 TAATAGATATAGAACAATTCAGG + Intronic
1096551316 12:52374489-52374511 TACTAGATATAGAGCTATTCAGG + Intergenic
1097932350 12:65202732-65202754 TAATAGGTATAGTCCTATTCAGG + Intronic
1098379839 12:69855588-69855610 TAATAGATATGGAGCTATTCAGG + Intronic
1098811530 12:75100070-75100092 AGATACGTACAGAGCTATTCTGG - Intronic
1099356337 12:81640229-81640251 GTATAGGTAAAGAACTCTTCAGG - Intronic
1100341139 12:93680276-93680298 TAAGAGTGATAGAACTATTCCGG + Intronic
1107198069 13:37678569-37678591 TAATAACTATAGGACTATTCAGG - Intronic
1107644203 13:42477264-42477286 TAATAGGCTTAGAACAATTCAGG - Intergenic
1108090307 13:46842728-46842750 TGTTATGTCTTGAACTATTCAGG + Intronic
1110022493 13:70492370-70492392 TGATAAGTATAGAAATATCTGGG + Intergenic
1110279882 13:73680916-73680938 TGACAGATATCGAACTATTCAGG + Intergenic
1110922998 13:81112139-81112161 TGGTAGGTATAGTACTATTCTGG + Intergenic
1111019229 13:82424959-82424981 TATTAGGTATAGGCCTATTCAGG - Intergenic
1111943168 13:94635475-94635497 TGATAGTTATAGGACTATTTTGG - Intergenic
1113417789 13:110143469-110143491 AAATAGTTATAGGACTATTCAGG - Intergenic
1114505736 14:23211324-23211346 TAATAGGTATAGAGATATTTAGG - Intronic
1115234287 14:31193031-31193053 TGATAGATATAGGATTATCCAGG - Intronic
1115759630 14:36566625-36566647 TAATAGATATAGAGCTATTCAGG - Intergenic
1117452809 14:55867222-55867244 TGATAGTCATAGAACTATTCTGG + Intergenic
1117698040 14:58386306-58386328 TTATAGATATAGGGCTATTCAGG - Intergenic
1119371548 14:74149383-74149405 TCATAGGTATTAAAATATTCTGG + Intronic
1120123336 14:80709697-80709719 TGAAAGATATAGAAGTATACTGG - Intronic
1122063426 14:99153921-99153943 TAATACATATAGCACTATTCTGG + Intergenic
1123465759 15:20513973-20513995 TAACAGATACAGAACTATTCAGG + Intergenic
1123652355 15:22487066-22487088 TAACAGATACAGAACTATTCAGG - Intergenic
1123742777 15:23295925-23295947 TAACAGATACAGAACTATTCAGG - Intergenic
1123760548 15:23428563-23428585 TAACAGATACAGAACTATTCAGG + Intergenic
1124268489 15:28259041-28259063 TAACAGATATAGAAGTATTCAGG - Intronic
1124276483 15:28329950-28329972 TAACAGATACAGAACTATTCAGG + Intergenic
1124306218 15:28581657-28581679 TAACAGATACAGAACTATTCAGG - Intergenic
1125116260 15:36095508-36095530 TTACAGGTATATAGCTATTCAGG - Intergenic
1125215294 15:37265640-37265662 TAATAGGTAAAGGACTGTTCAGG - Intergenic
1128586673 15:68858454-68858476 AGATATATATTGAACTATTCTGG - Intronic
1131104180 15:89719388-89719410 TAATAGATAAAGCACTATTCAGG + Intronic
1131996646 15:98139479-98139501 TGATAGGGATAGAGCAAGTCGGG + Intergenic
1134873165 16:17670126-17670148 TAATGGCTATAGCACTATTCCGG + Intergenic
1135153530 16:20031847-20031869 TGATTGGTGTAGAACTGTACAGG + Exonic
1135273566 16:21090141-21090163 CAATAGTTATAAAACTATTCAGG - Intronic
1136687869 16:32006049-32006071 TAGGAGGTATAGGACTATTCAGG - Intergenic
1136788471 16:32949604-32949626 TAGGAGGTATAGGACTATTCAGG - Intergenic
1136881343 16:33904327-33904349 TAGGAGGTATAGGACTATTCAGG + Intergenic
1138848289 16:60594624-60594646 AGATAGGTATAGATTTATTTAGG + Intergenic
1203090668 16_KI270728v1_random:1211098-1211120 TAGGAGGTATAGGACTATTCAGG - Intergenic
1143856355 17:9853682-9853704 TAATAGATATAGGACTATTCTGG - Intronic
1143887309 17:10074608-10074630 TGAAGGTTATAGACCTATTCAGG - Intronic
1146292986 17:31624981-31625003 TTATAGTTATATGACTATTCAGG - Intergenic
1147148853 17:38501725-38501747 TAGGAGGTATAGGACTATTCAGG - Intronic
1150296897 17:64015398-64015420 TAATAGTTATAGAACCATTTAGG - Intronic
1150503136 17:65670256-65670278 TGATACCTATATAACTATTAGGG - Intronic
1150542779 17:66120536-66120558 TAATAGCTATAGGACTATGCAGG + Intronic
1159084076 18:63767841-63767863 TGATAGGTATAGAACTATTCAGG + Intronic
1161223237 19:3128665-3128687 TAATACGTATAGGACTGTTCAGG - Intergenic
1165646950 19:37448251-37448273 TAATAGATATACAACTATTCAGG + Intronic
1166578893 19:43874416-43874438 TGTTAGGAATAGAGATATTCAGG - Intronic
1166615861 19:44245575-44245597 TAATAGGTATAGGAATATTCAGG + Intronic
1166983579 19:46646772-46646794 TGATAGTTATAGTACTATTTAGG - Intergenic
1167790185 19:51671858-51671880 GAATAGTTTTAGAACTATTCAGG + Intergenic
925667139 2:6270569-6270591 TAATAGACATAGAACTCTTCAGG - Intergenic
927816837 2:26225052-26225074 TAATAGATATAGGGCTATTCAGG - Intronic
929643254 2:43602844-43602866 TTTTAGATATAAAACTATTCAGG - Intergenic
929976174 2:46637586-46637608 TGATAGTAATATAACCATTCTGG + Intergenic
931435730 2:62244390-62244412 TAACACATATAGAACTATTCGGG - Intergenic
932970349 2:76533573-76533595 ACATAGGTATAGGACTCTTCTGG + Intergenic
934906102 2:98205206-98205228 TAATAACCATAGAACTATTCAGG + Intronic
935375943 2:102397549-102397571 TGAAAGATAAAGAGCTATTCTGG - Exonic
938006454 2:127790790-127790812 TAATAGATATAGGACTATTCAGG + Intronic
939422239 2:141987267-141987289 TGATATGTATGTAATTATTCAGG + Intronic
940473981 2:154136667-154136689 TGAAAGGTATAAAATGATTCTGG + Intronic
941248392 2:163130545-163130567 TTATATGGATAGAATTATTCTGG + Intergenic
944848345 2:203691291-203691313 AGATTGTTATAGAACTCTTCTGG - Intergenic
945006964 2:205418991-205419013 TTATAAGTATAGAAATATTTTGG - Intronic
945519011 2:210799898-210799920 TGATAAAAATAGAACTAGTCTGG - Intergenic
948744937 2:240082866-240082888 TAATAGATATAAGACTATTCAGG - Intergenic
1170162700 20:13330689-13330711 TAATATTTATAGAACTATTCAGG + Intergenic
1172521593 20:35570366-35570388 TAATACTTATAGTACTATTCAGG + Intergenic
949221215 3:1636315-1636337 GGATAGGTATAGAACAAGTCTGG + Intergenic
956802642 3:72775381-72775403 TAATTGTTATAGGACTATTCCGG - Intronic
958521196 3:95188639-95188661 TGTAAGGTATAGAAAAATTCAGG + Intergenic
959239473 3:103770732-103770754 CAATGGCTATAGAACTATTCTGG - Intergenic
960230765 3:115224196-115224218 TAATAGGTACAGGACTATTAAGG - Intergenic
960309588 3:116104881-116104903 TGATAAGTCTAGAAAAATTCTGG - Intronic
962121391 3:132564441-132564463 CAATAGTTGTAGAACTATTCAGG + Intronic
962220305 3:133559368-133559390 GGATACATATAGGACTATTCAGG - Intergenic
964089279 3:152854813-152854835 TGAGAGTTTTAGAAATATTCTGG - Intergenic
965091590 3:164169991-164170013 AGAGAGGTATAGAACATTTCAGG - Intergenic
965279700 3:166734263-166734285 TATTAGGTATAGAATTTTTCAGG + Intergenic
965375633 3:167920092-167920114 TGATAGTTAAAGAAGAATTCTGG - Intergenic
965463921 3:169003569-169003591 GAATAGGGAAAGAACTATTCTGG - Intergenic
966250968 3:177865273-177865295 TGATATGTATAGATCTACTCAGG - Intergenic
966771250 3:183505851-183505873 TAATAGATATAGGACTATTTAGG - Intronic
967532000 3:190559065-190559087 TAATAGTTATTGGACTATTCAGG + Intronic
967809860 3:193748989-193749011 TAATAGATATAGGGCTATTCAGG + Intergenic
969659925 4:8520812-8520834 TAATAGATGTAGAGCTATTCAGG - Intergenic
970392057 4:15622245-15622267 TTATAGGAATAGAAATGTTCAGG - Intronic
970715716 4:18920188-18920210 TGATAGGTATAGTACGACACAGG + Intergenic
971685239 4:29757158-29757180 TTATAGGTCTAGAAGTATTGGGG - Intergenic
973075559 4:45920858-45920880 TGATAGGTATGGAGTTATGCAGG + Intergenic
975049124 4:69837956-69837978 TAATGGTTATAGGACTATTCAGG + Intronic
976573746 4:86644099-86644121 TAATAGATATAGGACAATTCGGG - Intronic
976925972 4:90496212-90496234 TGACAGTTACAGAACTATTCAGG + Intronic
976981508 4:91237183-91237205 TGACAGGTATAAAAATAGTCAGG - Intronic
978860295 4:113441083-113441105 TAATAGATATAGGCCTATTCAGG - Intergenic
979388869 4:120102928-120102950 TAATAGATACAGAACTATTCCGG - Intergenic
982600104 4:157438425-157438447 TTACAGTTATAGAACAATTCAGG - Intergenic
982920863 4:161273385-161273407 TGATAAGGATAGTACAATTCAGG + Intergenic
983809868 4:172048356-172048378 TGATATGTCCAGAACTATTTTGG + Intronic
984014542 4:174410324-174410346 TAATAGGTATAGGACAATTAAGG - Intergenic
986456108 5:7920757-7920779 TAATAGGTATTGGAATATTCAGG + Intergenic
986853081 5:11835494-11835516 TAATAGCTATAGAATTATTCAGG + Intronic
988128249 5:27071735-27071757 TGATAGGTATTAAAATACTCTGG + Intronic
988290636 5:29280556-29280578 GGATAGCTAGAGAATTATTCTGG - Intergenic
989433144 5:41379040-41379062 TGCTAAGCATAGAACTATGCTGG + Intronic
990804091 5:59638421-59638443 TGTTAGGCATAGAACTGCTCAGG - Intronic
990839960 5:60067171-60067193 TGAAAGATATAGAACTGCTCAGG - Intronic
990991777 5:61691474-61691496 TAATAGTTATAGAACTATTTAGG - Intronic
992621690 5:78600144-78600166 TGAAATTTTTAGAACTATTCAGG - Intronic
993053961 5:82958816-82958838 AAATAGATATAGAACTATTTAGG - Intergenic
993249027 5:85491909-85491931 TTATAGATATAAGACTATTCAGG - Intergenic
995496491 5:112749793-112749815 TAATAGTTGTAGAACTATTAAGG + Intronic
995680289 5:114710063-114710085 TGATAGGTATAGAACTGGCTTGG - Intergenic
996233594 5:121098706-121098728 TAATAGGTAAAGCCCTATTCAGG - Intergenic
997414864 5:133718996-133719018 TGATAGATATAAAAATATTTTGG + Intergenic
999709702 5:154307206-154307228 CAATAGATATAGGACTATTCAGG - Intronic
999851571 5:155545926-155545948 TAATAGTTATAGAACTATTCAGG + Intergenic
1000912771 5:167042474-167042496 TGAAAGGTATATAAATATTCAGG + Intergenic
1003036871 6:2648066-2648088 TAATAGATACAGAATTATTCTGG - Intergenic
1003811783 6:9791406-9791428 TAATAGTTAAAGGACTATTCAGG - Intronic
1006662529 6:35659561-35659583 TAATAGATATAGGACTTTTCAGG + Intronic
1007967982 6:46020879-46020901 TAATAAATATAGGACTATTCAGG - Intronic
1008258593 6:49336340-49336362 TCATAGATATAGAAAAATTCAGG - Intergenic
1010105908 6:72167615-72167637 TAATAGCTAAAGGACTATTCGGG + Intronic
1011022441 6:82829386-82829408 AGGTAGGTTTAGAAGTATTCTGG - Intergenic
1011458686 6:87580069-87580091 TCACAGGTTTAGAATTATTCTGG + Intronic
1011510471 6:88094647-88094669 TAATAGATATAGAGCTATTGAGG + Intergenic
1015142049 6:129946274-129946296 TGGTAGTTATTGATCTATTCAGG + Intergenic
1015352471 6:132237468-132237490 TGATGGGTAGAGAACTAATTTGG - Intergenic
1016406046 6:143731893-143731915 TTATAGTTATAGGACCATTCAGG + Intronic
1017803147 6:157917078-157917100 TCATAGCTATAGGACTATTCAGG + Intronic
1018123295 6:160657964-160657986 TTATAGGTCTAGAAGCATTCAGG + Intronic
1021232648 7:18104367-18104389 TGATAGATATTGAAATAGTCTGG - Intronic
1022636339 7:32139661-32139683 TGATTGGTATAAACCTATTATGG + Intronic
1023676801 7:42639083-42639105 TTATAGTTATAGGACTATTTAGG + Intergenic
1024464522 7:49698015-49698037 TGATAGGTATAAAAATACTTAGG - Intergenic
1028688992 7:93628204-93628226 TTATAGGTAGAGATTTATTCAGG + Intronic
1030795872 7:113787436-113787458 TGGTAGATATAGAAATATTCGGG - Intergenic
1031001483 7:116420659-116420681 AGATAGGTCTTAAACTATTCTGG - Intronic
1031221310 7:118969308-118969330 TGAAAGGCATACAAATATTCAGG - Intergenic
1031480143 7:122268496-122268518 TGATAGGAATTGAAATATGCAGG + Intergenic
1032678126 7:134151361-134151383 TTATAGTTATAGGACTACTCAGG - Intronic
1034166800 7:149031104-149031126 TAATAGATATAGGGCTATTCAGG + Intergenic
1035196141 7:157222200-157222222 TGAGAGTTATAAAGCTATTCTGG + Intronic
1038051129 8:23812885-23812907 TGTTAGATGTAGAGCTATTCAGG - Intergenic
1045707226 8:104938949-104938971 TAATAGATATAGGGCTATTCAGG + Intronic
1046168279 8:110469571-110469593 TGAAAGTTACAGAAATATTCAGG - Intergenic
1051391929 9:16574507-16574529 TGGAAGGTATGGAACTATACTGG + Intronic
1055288633 9:74758109-74758131 TAATAGATATAGAGCTATTTAGG - Intronic
1055916656 9:81408936-81408958 TAATAGTTATAGAACTATTATGG - Intergenic
1057056803 9:91969380-91969402 TAATAGATACAGAATTATTCAGG - Intergenic
1057284206 9:93736120-93736142 TAATAGACATAGGACTATTCAGG + Intergenic
1057538229 9:95937523-95937545 TAATAGTTATAGGACTATTCAGG + Intronic
1057876897 9:98763936-98763958 TAATAGATATAGGACTATTCAGG - Intronic
1060083137 9:120671576-120671598 TAATAGGTATAGGACCATTAAGG - Intronic
1060251720 9:121991743-121991765 TGATTTGTATGGCACTATTCTGG - Intronic
1061269353 9:129528587-129528609 TGAAAGTTACAGAATTATTCTGG + Intergenic
1185678667 X:1870078-1870100 TGGTAGACATAGAACTATTCAGG - Intergenic
1186869701 X:13758792-13758814 TGATAGATATATAAATATACAGG + Intronic
1187356544 X:18578387-18578409 TGATAGGTATACAACTTGACTGG + Intronic
1188827713 X:34856638-34856660 TGATAGGTATAGGTTTGTTCAGG + Intergenic
1189645393 X:43123328-43123350 TCATAGATATAGGATTATTCTGG + Intergenic
1189763526 X:44346073-44346095 AGATAGATATAGAGATATTCTGG + Intergenic
1189909285 X:45793999-45794021 TAATGGTTATAGGACTATTCAGG + Intergenic
1192285507 X:69731036-69731058 TAGTAGATATAGAACTGTTCAGG + Intronic
1196014859 X:110927931-110927953 TAATAGATATATAGCTATTCTGG - Intergenic
1196930619 X:120677769-120677791 AAATAGTTATAGGACTATTCAGG + Intergenic
1197108927 X:122749178-122749200 TTATAGATATAGAACTTTTGAGG + Intergenic
1197310291 X:124896473-124896495 TTGTAGCTATAGAACTATTTTGG - Intronic
1197324421 X:125074496-125074518 TGCTAGAAATAGAATTATTCTGG - Intergenic
1198273389 X:135077227-135077249 TAATATATATAGAACTCTTCTGG + Intergenic
1199461138 X:148086695-148086717 TAATTGTTATAGAACTACTCAGG - Intergenic
1200175309 X:154110692-154110714 TAATAGGTATAGGCCTATTCAGG + Intergenic