ID: 1159084615

View in Genome Browser
Species Human (GRCh38)
Location 18:63774573-63774595
Sequence AACCTACCTTTCCCTACACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 116}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159084607_1159084615 26 Left 1159084607 18:63774524-63774546 CCTGTGTGGCATGTTCTGATGGC 0: 1
1: 0
2: 2
3: 9
4: 107
Right 1159084615 18:63774573-63774595 AACCTACCTTTCCCTACACCTGG 0: 1
1: 0
2: 0
3: 4
4: 116
1159084605_1159084615 27 Left 1159084605 18:63774523-63774545 CCCTGTGTGGCATGTTCTGATGG 0: 1
1: 0
2: 1
3: 7
4: 134
Right 1159084615 18:63774573-63774595 AACCTACCTTTCCCTACACCTGG 0: 1
1: 0
2: 0
3: 4
4: 116
1159084604_1159084615 28 Left 1159084604 18:63774522-63774544 CCCCTGTGTGGCATGTTCTGATG 0: 1
1: 0
2: 0
3: 10
4: 199
Right 1159084615 18:63774573-63774595 AACCTACCTTTCCCTACACCTGG 0: 1
1: 0
2: 0
3: 4
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159084615 Original CRISPR AACCTACCTTTCCCTACACC TGG Intronic
900865758 1:5267643-5267665 CCCCTCCCTTGCCCTACACCCGG + Intergenic
903005884 1:20298485-20298507 ATCCCACCTTCCCCTACACAGGG + Intronic
904318529 1:29681576-29681598 ACCCCACCTGTCCCTGCACCTGG - Intergenic
918682702 1:187374785-187374807 AGCCTACCATTCCCTTCACCTGG + Intergenic
919579038 1:199348495-199348517 AACCTCCTTTTCCCTAAATCAGG - Intergenic
923441143 1:234021720-234021742 AACCTCCCTTTCCTTACCACTGG + Intronic
924687680 1:246312073-246312095 AATCTACTTGTCACTACACCAGG + Intronic
1063914326 10:10866275-10866297 AGCTCCCCTTTCCCTACACCAGG - Intergenic
1068738148 10:60438170-60438192 AACATAACTTTCAATACACCAGG + Intronic
1070893637 10:79963010-79963032 TACCTACCTTTCCTTATTCCTGG + Intronic
1074580415 10:114713560-114713582 AACCTACCATTTCCTACCACTGG + Intergenic
1075772452 10:124951277-124951299 AACCTCCCTTTCATTACACCAGG - Intronic
1078490688 11:11765380-11765402 AAAGTACTTTTCCCAACACCTGG + Intergenic
1080717003 11:34812564-34812586 AGCCTACCTTTCCATACTACTGG + Intergenic
1080794633 11:35552148-35552170 AACCTATTTTTCCTTACCCCAGG - Intergenic
1081542321 11:44044891-44044913 CATCTACCTTTCCATTCACCCGG - Intergenic
1083197440 11:61096987-61097009 CTCCTACCTGTCCCTAAACCAGG + Intergenic
1088406484 11:109485435-109485457 ACCCTACCTTTCCCAACCTCTGG - Intergenic
1088470550 11:110184399-110184421 GACCTGGATTTCCCTACACCAGG - Intronic
1088838845 11:113605045-113605067 TAGCTACCATTCCCTCCACCTGG - Intergenic
1090495305 11:127206006-127206028 ACCCCACCTTCCCCTACAGCTGG + Intergenic
1090500932 11:127260183-127260205 AACCAACCTCTCCCTATCCCTGG - Intergenic
1094619833 12:32069489-32069511 CCCCTACCTTTCTCTACACTGGG + Intergenic
1095740085 12:45597216-45597238 AACCTACCTTTCTCTAGAGGCGG - Intergenic
1097870180 12:64595431-64595453 AACCTACTTCCCCCTGCACCTGG + Intergenic
1098784224 12:74729402-74729424 ACCCAACCTTTCCCAGCACCGGG + Intergenic
1101828461 12:108239239-108239261 CACCTACGTTTCCCAGCACCTGG + Intronic
1102954793 12:117052536-117052558 CACCTTCCTTTCTCCACACCAGG + Intronic
1104575320 12:129961548-129961570 AAACTACATTTCCCTACTACTGG + Intergenic
1105704502 13:22960854-22960876 AACCTACCTGTCCCCTCAGCTGG - Intergenic
1109862467 13:68218232-68218254 AACTTACCACTCCCTTCACCAGG + Intergenic
1111811432 13:93096974-93096996 AACCCCCCTCTCCCTACCCCCGG + Intergenic
1111894238 13:94120878-94120900 TACCTCCCTTTCCCAACAGCCGG + Intronic
1112236431 13:97642080-97642102 ACCCCACCTCACCCTACACCTGG + Intergenic
1113112357 13:106837216-106837238 CACATACCTTTCCCCCCACCAGG + Intergenic
1113269980 13:108662651-108662673 AACCCATCTTGCCCTCCACCTGG - Intronic
1113739999 13:112704932-112704954 AACCTCCCATCCCCCACACCAGG - Intronic
1115953079 14:38743886-38743908 AGAGTACCTTTCCCTCCACCTGG - Intergenic
1120340735 14:83217625-83217647 ACCATCCCTTTCCCAACACCAGG - Intergenic
1124913953 15:33950368-33950390 AACACACCTTTCACTACACATGG - Intronic
1124996599 15:34728985-34729007 AACTTACCTTTCTTTATACCTGG + Intergenic
1130983478 15:88828940-88828962 AACCTTTCTTTCCCTTCACTGGG + Intronic
1131379679 15:91953639-91953661 AACCTCACTTTCCCCACTCCTGG - Intronic
1132334681 15:101038575-101038597 CACTTACCTTTCCCCACACTGGG + Intronic
1133025831 16:2988607-2988629 CACCTACCTTTCCCCAGGCCAGG - Intergenic
1138341104 16:56289603-56289625 ATCCTTCCTCTCCCCACACCGGG - Intronic
1138392171 16:56677738-56677760 AACACAGCTTTCCCTACATCAGG - Exonic
1139101814 16:63776785-63776807 AAGATACCTTTCCCTACTTCTGG - Intergenic
1140114885 16:72033490-72033512 AACAAAACTTTCTCTACACCTGG - Intergenic
1147158271 17:38556323-38556345 AATCTACCTTTGCCTAACCCAGG - Intronic
1147305954 17:39564497-39564519 AACCAACCATTCCCTATAGCTGG + Intronic
1152254172 17:79227764-79227786 AGCCTACCTTCCCCTGCCCCTGG - Intronic
1152852272 17:82644382-82644404 ACCCTGCCCTTCCCTTCACCTGG - Intronic
1159084615 18:63774573-63774595 AACCTACCTTTCCCTACACCTGG + Intronic
1161282983 19:3455848-3455870 CACCCCCCTTTCCCTGCACCGGG + Intronic
1161624665 19:5319472-5319494 CACCCACCTTTGCCTTCACCTGG + Intronic
1162367512 19:10258391-10258413 AACCATCCTTTCCTTCCACCAGG + Exonic
1163537322 19:17884157-17884179 CACCTACCGTTCCCTCCCCCAGG - Intronic
1168398666 19:56069969-56069991 AGCCTACCCTACCTTACACCTGG - Intergenic
1168595301 19:57670730-57670752 AAAAGACCATTCCCTACACCTGG - Intronic
927188481 2:20499636-20499658 CACCCACCTCTCCCTGCACCTGG - Intergenic
928676254 2:33654574-33654596 AAGCCACCATTCCCAACACCCGG - Intergenic
929266172 2:39920950-39920972 CACTTACCTTTCCCTGCACTGGG + Intergenic
929459542 2:42092342-42092364 AACCTACCCTTTCCTCCACAGGG - Intergenic
932783028 2:74574816-74574838 CACATGCCTTTCCTTACACCTGG + Intronic
933774300 2:85762606-85762628 GACCTCCCCTACCCTACACCAGG - Intronic
935043711 2:99459787-99459809 AACCTATTCTTCCCTTCACCTGG - Intronic
935338984 2:102042954-102042976 CACTCATCTTTCCCTACACCTGG - Intergenic
1169919510 20:10719414-10719436 AAACCACCTTTCTCTACCCCTGG - Intergenic
1172022744 20:31925774-31925796 CACCTACCGTTTCCTCCACCCGG - Intronic
1173144793 20:40515250-40515272 CACCTGCTTTTCCCTGCACCTGG + Intergenic
1174236746 20:49100079-49100101 AACACACCTTTACCTACACTGGG + Intergenic
1174745335 20:53056743-53056765 ATCCCATCTTTCCCTGCACCTGG + Intronic
1174946774 20:54994757-54994779 AAGCTACCTTCCCCTACTCTGGG - Intergenic
1175361656 20:58415941-58415963 AACCTTCCTCTCCCTACTCTGGG - Intronic
1180081396 21:45489397-45489419 AACTCACCCTTCCCTTCACCCGG + Intronic
1180340271 22:11612491-11612513 AACCCACCTCACCCTCCACCCGG + Intergenic
1182707302 22:32292850-32292872 AACCTACCTCTCTCTACAACAGG - Intergenic
1184134714 22:42540734-42540756 TAACTCCTTTTCCCTACACCAGG + Intergenic
1184442943 22:44529682-44529704 AACCTTTCCTTCCCTTCACCTGG + Intergenic
954576895 3:51681241-51681263 AAACTTCCTCTCCCTCCACCTGG - Intronic
955308661 3:57861457-57861479 AACATACCTTTCCTTACTACAGG + Intronic
955766729 3:62352072-62352094 TACCTACCTTTTCTTCCACCAGG - Intergenic
957294462 3:78319371-78319393 GACATCCCTTTCCCTACACATGG - Intergenic
958069848 3:88596220-88596242 AAGCTTCCTTTCCAAACACCTGG + Intergenic
958221489 3:90689130-90689152 AACCTTCCTTTCAATACAGCAGG - Intergenic
960369627 3:116817791-116817813 GCCCTACATTTCCCTGCACCTGG - Intronic
964703363 3:159592980-159593002 GACCTCCCTCTCCCTACTCCAGG - Intronic
964703498 3:159594064-159594086 AAGGTTCCTTTCCCTACACAGGG - Intronic
974326647 4:60422922-60422944 AAACTGCCTTTCCCTGCAACTGG - Intergenic
976005017 4:80419565-80419587 AGCCTACCTTTCCCTAGTGCCGG + Intronic
977670412 4:99688589-99688611 CTCCTACCTCTCCCTACCCCTGG + Intergenic
977681453 4:99802687-99802709 AATTTTCCTTTCCCTACACAGGG - Intergenic
977719622 4:100224165-100224187 AACCTACCTTCCCCAGCAGCAGG - Intergenic
979912756 4:126390351-126390373 AAACTACCTGTCCCAGCACCTGG + Intergenic
986412397 5:7493836-7493858 AACCTGCCTTCCCCTAGGCCAGG - Intronic
988729712 5:33959449-33959471 CAACCCCCTTTCCCTACACCAGG - Intronic
989863614 5:46417899-46417921 AACATACCTTTTCCTACAGCAGG - Intergenic
997300205 5:132798098-132798120 AACCCTCCTTTCCCTCCCCCAGG - Intronic
998002383 5:138635266-138635288 CAGCTACCTTTCCCTCCAGCTGG - Intronic
1002476472 5:179469210-179469232 AACGTGGCTTTCCCTACAACGGG - Intergenic
1002509684 5:179705915-179705937 AGACTACATTTCCCTGCACCCGG - Intronic
1018038759 6:159903686-159903708 ACCCTGCCTTCCCCTTCACCAGG + Intergenic
1022834371 7:34099964-34099986 CTCCTACCTTTGCCTACAACAGG + Intronic
1023720067 7:43083992-43084014 AAGCTACCTTTCCCAGCAACTGG - Intergenic
1023887218 7:44367886-44367908 TACCTACCCCTCCCTACCCCAGG + Intergenic
1027946087 7:84748437-84748459 AACATCCCTTTCCCAACCCCAGG + Intergenic
1028108746 7:86912994-86913016 CACCTACCTGTCCATACATCAGG - Exonic
1030520793 7:110595536-110595558 AACCTACCTTTCTGTACAGGGGG - Intergenic
1040430931 8:47341607-47341629 AACTTTTTTTTCCCTACACCTGG + Intronic
1041401980 8:57455965-57455987 AACCTGGCTTTGCCTACTCCTGG + Intergenic
1041785965 8:61635030-61635052 AGCCTACTTTTCCTTACTCCAGG + Intronic
1043005117 8:74809297-74809319 AAACTGCCTTTCCCTGCAGCAGG - Intronic
1052461300 9:28767071-28767093 ACCCCACCTTCCCCCACACCTGG - Intergenic
1058733836 9:107876227-107876249 AACCTTCCTTTCCTGACAGCTGG + Intergenic
1060142584 9:121223216-121223238 AAACTGCCTTTCCCTAGCCCTGG + Intronic
1060183246 9:121548041-121548063 TACCTGCTTTTCCCTACCCCTGG + Intergenic
1062210147 9:135359149-135359171 CACGTACCTTACCCTACAGCTGG + Intergenic
1062511901 9:136910898-136910920 AAGCATCCTTTCCCTTCACCTGG + Intronic
1062643842 9:137536328-137536350 ACCCTTCCTTCCCCTACACAGGG - Intronic
1191644893 X:63469559-63469581 AAACTATCTTTCCTGACACCTGG - Intergenic