ID: 1159084817

View in Genome Browser
Species Human (GRCh38)
Location 18:63776609-63776631
Sequence CTGGTATGAAGCATAGTTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 156}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159084813_1159084817 9 Left 1159084813 18:63776577-63776599 CCTTAAGATAGTGCGAATTGAAA 0: 1
1: 0
2: 0
3: 3
4: 106
Right 1159084817 18:63776609-63776631 CTGGTATGAAGCATAGTTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 156
1159084812_1159084817 21 Left 1159084812 18:63776565-63776587 CCTTCTTGTGTGCCTTAAGATAG 0: 1
1: 0
2: 0
3: 5
4: 99
Right 1159084817 18:63776609-63776631 CTGGTATGAAGCATAGTTTTTGG 0: 1
1: 0
2: 1
3: 14
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159084817 Original CRISPR CTGGTATGAAGCATAGTTTT TGG Intronic
909621691 1:77675020-77675042 CAGGTAAGAATCATAGGTTTGGG + Intronic
910345248 1:86228909-86228931 GGAGTATGAAGAATAGTTTTTGG - Intergenic
910451508 1:87351353-87351375 CTGGAATGTATCATGGTTTTTGG - Intergenic
913178768 1:116299028-116299050 TTGATCTGAAGCAGAGTTTTGGG - Intergenic
914826343 1:151140202-151140224 TTGGTATTAAGAATAGCTTTTGG - Intronic
921704714 1:218309382-218309404 CTGATATAAAGCATATTTCTTGG + Intronic
923281981 1:232452233-232452255 CTGGTAGGAAACTTAGCTTTAGG - Intronic
923851263 1:237797685-237797707 ATGGAATGAAGCATAATTTCTGG + Intronic
924248016 1:242103915-242103937 CAGGTGAGAAGCATTGTTTTTGG + Intronic
1064134326 10:12737310-12737332 CTGGTATGAAGCACAGGTTAGGG - Intronic
1065044484 10:21734622-21734644 TTGTTATTAAGCATACTTTTGGG + Intronic
1066793463 10:39092225-39092247 CTGGTTGGAAACATTGTTTTTGG + Intergenic
1066796346 10:39125713-39125735 CAGGTTTGAAACATGGTTTTTGG + Intergenic
1068143749 10:53039398-53039420 ATGCTATAAAGAATAGTTTTTGG + Intergenic
1068467092 10:57408416-57408438 CTAGTATTTGGCATAGTTTTAGG + Intergenic
1068477266 10:57544167-57544189 GTGGTATGAAACATAGGTTGAGG - Intergenic
1069381424 10:67846434-67846456 CAGGTTTGAAGGTTAGTTTTGGG - Intergenic
1070344999 10:75532883-75532905 TTTGTATGAAGCCTGGTTTTGGG + Intronic
1070610468 10:77928724-77928746 ATGGTTAGAAGCATATTTTTTGG + Intergenic
1071232156 10:83601061-83601083 CTGTTATAAGGCATAGTTTTGGG - Intergenic
1072887348 10:99290328-99290350 AAGGTATGAGGCATAGTGTTGGG - Intergenic
1073664642 10:105517096-105517118 CTGGCATGAGGCATTGCTTTAGG + Intergenic
1074726319 10:116313744-116313766 TTGGCATGAACAATAGTTTTTGG - Intergenic
1075770324 10:124929129-124929151 CTGGAATGAAGCAAACTTTTGGG + Intergenic
1078484258 11:11707033-11707055 CTGTTGTGAAGCATAGTGTAGGG + Intergenic
1084592209 11:70097356-70097378 CTGCTATGAAGCACAGTTGAGGG - Intronic
1085347228 11:75776030-75776052 CTGGTATGAATGTTAGTGTTTGG + Intronic
1087883783 11:103452075-103452097 ATGGTAAGTAGCACAGTTTTAGG + Intronic
1090438197 11:126704317-126704339 CTGGTAGGAAGCATGTTTGTCGG + Intronic
1093883088 12:24428023-24428045 CTGGAATGCAGTATAGTATTTGG - Intergenic
1094242171 12:28241453-28241475 TTTGTATGAAGAATAGTTCTAGG + Intronic
1099981621 12:89610869-89610891 CTGATATGGAGCATATTTTAGGG - Intronic
1101267600 12:103105535-103105557 CTGGTAGGGAGCATAGTACTTGG - Intergenic
1104534104 12:129602300-129602322 CTAGTATCCATCATAGTTTTTGG - Intronic
1106021712 13:25921786-25921808 ATGGTTTGAAGTATAGTTTATGG + Intronic
1108139719 13:47407672-47407694 CTGGGATCTAGCATAGTTCTAGG - Intergenic
1108411803 13:50156517-50156539 CATCTATGAAGAATAGTTTTAGG + Intronic
1109172102 13:59109204-59109226 TTGGAATGAGGCAAAGTTTTTGG - Intergenic
1110545414 13:76749957-76749979 CTGGTATATAGCATAGTTCCTGG + Intergenic
1111166366 13:84462898-84462920 CTGGTAGGAAAAATAGGTTTGGG - Intergenic
1111994663 13:95152981-95153003 TATGTATAAAGCATAGTTTTTGG - Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114829698 14:26125702-26125724 CTAGTAGGTAGCATAATTTTAGG + Intergenic
1117738049 14:58787611-58787633 CTGGTTTGGAGCATGGTTTCTGG + Intergenic
1118536771 14:66775125-66775147 CAAGTAATAAGCATAGTTTTTGG + Intronic
1118561113 14:67084015-67084037 CTAGTATCAAGCACAGTGTTTGG - Intronic
1125915119 15:43479839-43479861 CTGGTATGAAACATGTTTTCTGG - Exonic
1126765143 15:52004121-52004143 CTGGGATGAAGATTATTTTTAGG + Intronic
1128363315 15:66978190-66978212 CTGGTTTAAAGCCCAGTTTTTGG + Intergenic
1128432980 15:67617481-67617503 CTGGGATGATTCATATTTTTTGG + Intronic
1131503241 15:92990854-92990876 TTGGTATGTAGCATAGTTTAGGG + Intronic
1131547457 15:93327864-93327886 CTGGGATGCAGCTTGGTTTTAGG - Intergenic
1132376494 15:101331631-101331653 CTGGTTTGAAGCATACTTACTGG + Exonic
1135841706 16:25882725-25882747 ATGGCATGAAGCAAAGTCTTGGG + Intronic
1140338318 16:74132772-74132794 ATGGTATGAAGAATAATTCTGGG + Intergenic
1143802160 17:9392286-9392308 TTGCTAAGAAGCATAGTTGTTGG + Intronic
1144359042 17:14474019-14474041 CTGCTATGACGCATAGCTATAGG + Intergenic
1146209833 17:30933487-30933509 CTGGTTTGAAGAATAATTTATGG - Intronic
1146748352 17:35352462-35352484 CTGGAAAGGAGCATAGTGTTTGG - Exonic
1146756895 17:35440689-35440711 CTGGAAAGGAGCATAGTGTTTGG - Exonic
1148993511 17:51686817-51686839 CTAGTATCAAGCTTACTTTTGGG - Intronic
1155454214 18:25993850-25993872 TTGTTATGCAGCATTGTTTTTGG - Intergenic
1156518276 18:37699280-37699302 CTGATATGAAGAGAAGTTTTTGG + Intergenic
1157118564 18:44885988-44886010 CAGGTATGAAGCATAGTTTGTGG - Intronic
1159084817 18:63776609-63776631 CTGGTATGAAGCATAGTTTTTGG + Intronic
1159192942 18:65071812-65071834 CTGGTATGATGCATTGTATATGG - Intergenic
1160784289 19:892502-892524 CTGGGATGAAGCCTCGTATTTGG - Intronic
1163746985 19:19054529-19054551 ATGGTAGGAAGCATAGGGTTGGG + Intronic
1164536318 19:29088675-29088697 CTGGGATGAGGCAGAGTTATGGG - Intergenic
1165560282 19:36673247-36673269 CAGATATGAAGTATGGTTTTAGG + Intergenic
1165870245 19:38967013-38967035 CTTTTATGAATCATAGTTTTTGG - Intronic
1166047823 19:40239948-40239970 CTGGTACAAAGCACAGTCTTGGG - Intronic
1166475958 19:43124863-43124885 CTGGAATGAAGTATCTTTTTGGG + Intronic
925011749 2:490775-490797 CTGGTATTATCCATAGTTTCAGG + Intergenic
925776833 2:7344059-7344081 CTGGGATGAGGCATGGTCTTTGG + Intergenic
926466071 2:13190383-13190405 CTGGTATGCAGAAAAGTGTTAGG + Intergenic
926872601 2:17439779-17439801 CAAGTATCAAGCACAGTTTTAGG + Intergenic
929263852 2:39896552-39896574 ATGGTATGAAGAAGAGTTTGTGG + Intergenic
931044205 2:58331869-58331891 CTGTTAGGAAACAAAGTTTTTGG - Intergenic
934885928 2:98024799-98024821 CTTTTAAGCAGCATAGTTTTTGG + Intergenic
939291419 2:140200834-140200856 TTGGGATAAAGCATTGTTTTGGG - Intergenic
941070442 2:160948784-160948806 CTGGTCTAAAGCAATGTTTTGGG - Intergenic
941278742 2:163523728-163523750 CTGATAAAAAGCAAAGTTTTAGG - Intergenic
943732702 2:191319752-191319774 CTCCTTTGAACCATAGTTTTGGG + Intronic
943795666 2:191989827-191989849 CAGTTCTGGAGCATAGTTTTGGG - Intronic
1169815358 20:9650733-9650755 CTGGCATGTAGCATACTTGTGGG + Intronic
1170176780 20:13479788-13479810 CTTGTATGAAGAATAGTTGTAGG - Intronic
1170690816 20:18613693-18613715 CTGGTGTGATGCATACTTTGAGG + Intronic
1174584099 20:51594095-51594117 TTGGTATCAAGCATAGGTTGTGG + Intergenic
1174908007 20:54572956-54572978 CCTGTATAAAGCATGGTTTTTGG + Intronic
1177040822 21:16108111-16108133 CATGTATGAAGTATAGATTTGGG - Intergenic
1178541882 21:33458781-33458803 CTGGTATGAAGCATATCTGAAGG - Intronic
1179072795 21:38088622-38088644 CTGGTATCCAGCATTGTTCTGGG - Intronic
1203295030 22_KI270736v1_random:33877-33899 CAGGTTTGCTGCATAGTTTTTGG - Intergenic
950047156 3:9955570-9955592 ATGGTGTGTAGCATAGTTTTTGG - Intergenic
953197563 3:40748712-40748734 CTGGGATGAAGCATGATTTTAGG + Intergenic
956152459 3:66258022-66258044 ATGGAATGAAGAATATTTTTTGG + Intronic
957011074 3:75007131-75007153 CACTTATGAAGCTTAGTTTTGGG + Intergenic
958127403 3:89374919-89374941 GTGGAATGAAGGATAGTTTGTGG - Intronic
961641370 3:128366670-128366692 CTGGTATCAGACATAGTGTTGGG + Intronic
964570022 3:158100582-158100604 CAGGTACCAAGCAGAGTTTTAGG - Intronic
964931128 3:162024750-162024772 CTGGGAGGAAGCACAGTTTGTGG - Intergenic
970736244 4:19171940-19171962 CTGGTTAGCAGCATAGGTTTGGG + Intergenic
972157414 4:36181715-36181737 CTGGTATTCAGAATAGGTTTGGG - Intronic
973338018 4:48975954-48975976 CAGTTATGCAGCATGGTTTTTGG + Intergenic
973830715 4:54756189-54756211 CTGGCAAGAAGCATAGTAATAGG + Intergenic
975929931 4:79508098-79508120 ATGGTATGAGGCACAGTTTGAGG + Intergenic
977256279 4:94743782-94743804 CTCTTATGAAGGATAATTTTTGG + Intergenic
977328371 4:95605757-95605779 TTTGTATGAAACAAAGTTTTGGG - Intergenic
979959704 4:127002567-127002589 CTGAAATCAGGCATAGTTTTGGG - Intergenic
980395207 4:132204252-132204274 ATGATATGAAGAATAGTTTAAGG + Intergenic
981114509 4:140974458-140974480 CTGCTATGAACATTAGTTTTTGG + Intronic
981676765 4:147351508-147351530 CCTGTATGAAGCATAGTTTAGGG - Intergenic
982318416 4:154055842-154055864 CTTGTAGGCAGCATATTTTTTGG + Intergenic
982631457 4:157834774-157834796 CAGGGATGAACCATAGATTTGGG + Intergenic
982741825 4:159065315-159065337 ATGGTATGAAACTTAGTTTATGG - Intergenic
983456946 4:167976997-167977019 TAGGTATGCAGCATTGTTTTGGG - Intergenic
983954664 4:173683166-173683188 CTTGTTTGGAGCAAAGTTTTGGG + Intergenic
986858236 5:11897111-11897133 CTGGTGTGGAGCATTGTTCTTGG - Intronic
986890683 5:12301389-12301411 CTGGTAGGCAGCATAGAGTTGGG - Intergenic
987017606 5:13836306-13836328 CTGGTTTGAGGCAGAGTTTGGGG + Intronic
987474952 5:18379921-18379943 CTGTTATGAACCATTGTTTTGGG + Intergenic
988812402 5:34798592-34798614 CTCTTAAGAAGCATAGTTCTTGG + Intronic
989306449 5:39962462-39962484 CTGGTATGGAGCACACTTTGAGG - Intergenic
992905437 5:81340658-81340680 CTGTTAAGAATCATACTTTTGGG - Intronic
992987456 5:82247668-82247690 CTGGTATGAACCACACTTTTTGG + Intronic
993982232 5:94557056-94557078 CTGGTAGGAAACATCATTTTGGG + Intronic
995359029 5:111272055-111272077 CTGGTATGAATCATGGTGTCTGG + Intronic
998538445 5:142956070-142956092 TTGGTATTAAGCATAATTGTGGG + Intronic
999065481 5:148681066-148681088 CTTATTTGAAGCACAGTTTTTGG - Intergenic
999160620 5:149493879-149493901 CTGGTATAAAGCATTATTTTAGG - Intronic
1000898597 5:166886683-166886705 CTGGTGTGAATAATAGTTTATGG + Intergenic
1002863535 6:1101179-1101201 CTGGTTTGAAGCTTAGTGCTTGG - Intergenic
1009431189 6:63568198-63568220 TGGGTATGAGGCCTAGTTTTCGG + Intronic
1012272572 6:97232724-97232746 CTTCTCTGAAGCATAATTTTAGG - Intronic
1014365374 6:120533846-120533868 CTTGTATGCAGCATATTGTTAGG - Intergenic
1016770040 6:147838960-147838982 CTGGAATAAATCACAGTTTTTGG + Intergenic
1020138209 7:5598256-5598278 CTGGTTTGATGCAAAGGTTTAGG - Intronic
1021060673 7:16106451-16106473 CTGCTATTAGGCATAGTTTCTGG - Intronic
1021097732 7:16552185-16552207 TTGTTATGAAGCATAATTTCAGG + Intronic
1021300140 7:18962487-18962509 CTGCTATGAGACACAGTTTTGGG + Intronic
1025080885 7:55981565-55981587 CTGGTAGGAAGCGAAGTCTTTGG + Exonic
1027545405 7:79521807-79521829 CTGGTTTGAAACATAGGATTGGG + Intergenic
1028963058 7:96771293-96771315 CTGGTCTCATGCATAGTTTCAGG - Intergenic
1029910030 7:104135736-104135758 CTGATATCAAGCACTGTTTTAGG + Intronic
1030683800 7:112462088-112462110 CTGATATGAAGCACTGTATTAGG - Exonic
1032501050 7:132400166-132400188 CTGGTATGAAGCTTGGTTCTGGG - Intronic
1033991731 7:147296200-147296222 CTGCTATGAAATACAGTTTTAGG - Intronic
1034476772 7:151289289-151289311 CAGGTGTGAGGCATAGTTGTGGG + Intergenic
1034612697 7:152386301-152386323 CTTCTATGAAGCACTGTTTTGGG - Intronic
1036510402 8:9394777-9394799 CTGGTATGAGACATGCTTTTAGG + Intergenic
1037100316 8:15035580-15035602 CTGGTAGGCAGCATATTGTTCGG - Intronic
1039384274 8:37118563-37118585 CAGGTATTAAGTATAGTTTATGG + Intergenic
1040925299 8:52675228-52675250 GTGGTATGAATATTAGTTTTTGG - Intronic
1046331852 8:112726551-112726573 CTAGTATTAAGCAGAGTGTTAGG + Intronic
1047628330 8:126679169-126679191 CTGGAAAGAAGCATAGCCTTGGG - Intergenic
1050362161 9:4840449-4840471 CTGTTATAAAGTCTAGTTTTAGG + Intronic
1050692399 9:8242599-8242621 CTGTTATGTAGCAAAGTATTTGG - Intergenic
1052015553 9:23461067-23461089 CTGGTCTGAAGTATAGTTGAAGG - Intergenic
1053057527 9:35002712-35002734 CTGGGATGAAACAGAGTTTGGGG + Intergenic
1186548479 X:10476996-10477018 TTGGTGTGTAGCATAGTTTAAGG - Intronic
1186961258 X:14738731-14738753 CTGGTTTGTAGCATCGGTTTAGG - Intergenic
1187683537 X:21792888-21792910 TTGGCATGAAGAATAATTTTTGG - Intergenic
1188945107 X:36290927-36290949 CTGATACAAACCATAGTTTTTGG - Intronic
1189023132 X:37363266-37363288 GTTGCATGAAGCATAGTTTTGGG + Intronic
1190087193 X:47405612-47405634 CTTGTATGCAGCATAGTGCTGGG + Intronic
1193256820 X:79358190-79358212 ATTGTGTGAATCATAGTTTTAGG - Intergenic
1195877077 X:109552715-109552737 TAGGTAGGAAGTATAGTTTTGGG + Intergenic
1197050479 X:122051985-122052007 CTGGTATGGAGGATTATTTTGGG - Intergenic
1197986899 X:132276212-132276234 CTGTTATTAAGCATAGTACTGGG - Intergenic
1198798983 X:140430675-140430697 CTGGTGTGATGATTAGTTTTGGG - Intergenic
1199474037 X:148226637-148226659 GTGGTCTGGAGCACAGTTTTTGG + Intergenic