ID: 1159085423

View in Genome Browser
Species Human (GRCh38)
Location 18:63784173-63784195
Sequence TACTGTGTGCTGGTAGATGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159085418_1159085423 2 Left 1159085418 18:63784148-63784170 CCCTGATTTTATGGAGGGGTGAC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1159085423 18:63784173-63784195 TACTGTGTGCTGGTAGATGGCGG 0: 1
1: 0
2: 1
3: 17
4: 181
1159085419_1159085423 1 Left 1159085419 18:63784149-63784171 CCTGATTTTATGGAGGGGTGACC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1159085423 18:63784173-63784195 TACTGTGTGCTGGTAGATGGCGG 0: 1
1: 0
2: 1
3: 17
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159085423 Original CRISPR TACTGTGTGCTGGTAGATGG CGG Intronic
900712038 1:4120491-4120513 TTCTGTGTGCTGGTTTGTGGGGG + Intergenic
902763196 1:18597811-18597833 TACTGTGAGCTGGTCCATGGAGG + Intergenic
904029488 1:27525469-27525491 TTGTGTGTGCTTGTACATGGGGG + Intergenic
904048323 1:27622876-27622898 AACTGTGTGCTGGTTGAGGGGGG - Intronic
904050042 1:27633502-27633524 AACTGTGTGCTGGTCCCTGGAGG + Intronic
904623023 1:31786891-31786913 TGCTGTCTGCTGGTGGATGGCGG - Intergenic
905822727 1:41006373-41006395 TACTGTGTTCTGGGAGTTGAGGG - Intronic
908352208 1:63297500-63297522 TACTGTGTGGTGGGTGGTGGGGG + Intergenic
910043213 1:82879675-82879697 CACTATGTAGTGGTAGATGGTGG + Intergenic
910512409 1:88021835-88021857 TTCTGTGGTCTGGTGGATGGTGG + Intergenic
911895321 1:103426342-103426364 TGCTGTGTGCTTTTAGATGAAGG - Intergenic
912247650 1:107977602-107977624 AACTGGGTGATGGTACATGGGGG - Intergenic
912381610 1:109250627-109250649 CACTGTGGCCTGGTAGCTGGGGG - Exonic
912951980 1:114126543-114126565 CACTGTGTGCTATTAGGTGGTGG + Intronic
917809345 1:178642404-178642426 TACTCTGTGCTTGCAGATGCAGG - Intergenic
918661663 1:187095828-187095850 TATTGACTGCTGATAGATGGTGG + Intergenic
919755223 1:201062306-201062328 GACTGTGTGTTGGTGGATGACGG - Intronic
920619268 1:207528072-207528094 TACTGGGTGCTGGCATTTGGAGG - Intronic
920621050 1:207546627-207546649 TACTGGGTGCTGGCATTTGGAGG - Intronic
920622828 1:207565196-207565218 TACTGGGTGCTGGCATTTGGAGG - Intronic
921310209 1:213834935-213834957 TAGTATGTGCTGGGAGGTGGGGG + Intergenic
922189065 1:223301263-223301285 GACTGTGTGCTGGGAGGTGTGGG - Intronic
923523682 1:234756415-234756437 GACTGTGTTCAGGTAGATGACGG - Intergenic
923678764 1:236102390-236102412 TACTGTGTGCTGGTGGCTTCGGG - Intergenic
1063731908 10:8707353-8707375 ACCTGTTTGGTGGTAGATGGTGG + Intergenic
1068678464 10:59793035-59793057 GTCTGTGTGTTGGGAGATGGAGG + Exonic
1070864465 10:79698972-79698994 TTCTGTGTCTTGGAAGATGGAGG - Intergenic
1071631364 10:87221202-87221224 TTCTGTGTCTTGGAAGATGGAGG - Intergenic
1073853758 10:107651629-107651651 TATTGTGGGATGGTAGATGAAGG - Intergenic
1075736257 10:124666386-124666408 TCCAGAGTGCTGGTAGATGGGGG + Intronic
1076623867 10:131809846-131809868 GACTGTGTGCTCTTTGATGGTGG - Intergenic
1077062340 11:623390-623412 TGCTGTGTGCTGGTAGGTGAGGG + Intronic
1077418891 11:2440170-2440192 CACTGGGGACTGGTAGATGGTGG + Intergenic
1077941577 11:6848814-6848836 TTCTGGGGTCTGGTAGATGGTGG - Intergenic
1078435588 11:11322369-11322391 GTCTGTGTGATGGTAGATGTTGG - Intronic
1079287790 11:19154864-19154886 GACTGTGTGCAGGTAGAAAGGGG - Intronic
1079391833 11:20028501-20028523 TGGTGACTGCTGGTAGATGGAGG + Intronic
1079472854 11:20796712-20796734 TACTGTGTGGTCATAGATGCTGG + Intronic
1081691239 11:45080111-45080133 TACTGGGTGCTGGTGGGGGGAGG - Intergenic
1081737555 11:45414572-45414594 TGCTGTGTGCTGGTTGAAAGAGG - Intergenic
1083110062 11:60397423-60397445 TACTGAGTGCTGGAAAATGTGGG + Intronic
1083417638 11:62535902-62535924 GACTGGGTGCTGGTGGTTGGGGG - Intronic
1083828893 11:65218485-65218507 CGCTGTGTGCTGGGAGAGGGAGG - Intergenic
1084643243 11:70438346-70438368 TACTGTGTGCTGGGCCTTGGAGG + Intergenic
1085652465 11:78280762-78280784 TTCTGTGAGCAGGTAGATGCAGG - Exonic
1086510994 11:87557973-87557995 TACTGTGTGCTGGTGAAGGGTGG + Intergenic
1089145843 11:116329196-116329218 TTGTGAGTGCTTGTAGATGGGGG - Intergenic
1089642030 11:119853966-119853988 TTCTGTCTGCTGGTAAATGTGGG + Intergenic
1090602826 11:128390413-128390435 TCCTGTGGGTTGGTAGAAGGAGG - Intergenic
1091094083 11:132802214-132802236 GACTGTGTGCTGGGGGAAGGAGG - Intronic
1091287978 11:134419292-134419314 TACTGGGTGCCGCTAGATGCTGG + Intergenic
1093353145 12:18128425-18128447 TACTGTGGTCTGGAGGATGGTGG - Intronic
1097621057 12:61940321-61940343 TCCTGGATGGTGGTAGATGGTGG + Intronic
1101711780 12:107274438-107274460 TACTGTGGAATGGTAGTTGGAGG + Intergenic
1103897951 12:124286366-124286388 TACTGTGTGCCGGTCAATGGGGG - Intronic
1104498769 12:129265340-129265362 TCCAGTGTTGTGGTAGATGGGGG + Intronic
1104638242 12:130451019-130451041 TACTATGTGCTGGAATGTGGGGG - Intronic
1104731313 12:131107021-131107043 CACTGTGTGCTGGCAGCAGGAGG + Intronic
1104979076 12:132565064-132565086 GGCTGGGTGCTGGGAGATGGGGG - Intronic
1105919726 13:24950827-24950849 GACTGTGTGTTGGGAGTTGGGGG + Intergenic
1106021550 13:25920506-25920528 CTCTGTGAGCTGGTGGATGGTGG - Intronic
1111335446 13:86815712-86815734 CACTGTGTGTTGGAGGATGGGGG - Intergenic
1112595991 13:100807227-100807249 TACTAAGTGCTGGTAGATGGTGG + Intergenic
1116119668 14:40706127-40706149 TACTGGGCTCTGGAAGATGGTGG + Intergenic
1116157649 14:41228366-41228388 TGCTGTGTGATGGTGGATGAAGG + Intergenic
1117118819 14:52547041-52547063 TACTGTGTGATGGTTGCTGTTGG + Intronic
1121591289 14:95113634-95113656 ATATGTGTGCTGGTAGTTGGTGG - Intronic
1121611563 14:95284415-95284437 TTCTGGGTTCTGGAAGATGGTGG - Intronic
1124230130 15:27937546-27937568 TACTGAGTGCTGAAAGATTGTGG - Intronic
1124695791 15:31863262-31863284 TTCTGTGGTCTGGAAGATGGTGG + Intronic
1124866400 15:33496278-33496300 TTATGTCTGCTGGTAGAAGGTGG - Intronic
1127679859 15:61282958-61282980 TACTGTGTGCCGTAAGCTGGTGG + Intergenic
1130870319 15:87966459-87966481 CACTGTGGGATGGAAGATGGGGG - Intronic
1132215303 15:100057780-100057802 TCCTGTGGGCTGGTAGATCCAGG - Intronic
1132969658 16:2680226-2680248 CACTGTGGGCAGGGAGATGGGGG - Intergenic
1134016315 16:10890948-10890970 TACAGTGTGTTGGTAGGTAGGGG + Intronic
1138406909 16:56803030-56803052 TACTGTCTACTGGTAGTTGCAGG - Intronic
1139622955 16:68162138-68162160 TGCTCTGTACTGGTAGATTGTGG + Intronic
1139844126 16:69907130-69907152 TACTGTGAACTGGTGCATGGAGG + Intronic
1141248572 16:82333738-82333760 TACTGGGTGCTGGGGGTTGGGGG + Intergenic
1142792279 17:2276710-2276732 TACTGTGAAGTGGTAGAAGGAGG - Intronic
1144150266 17:12436284-12436306 AAGTGTGTGCTAGTGGATGGAGG + Intergenic
1148344758 17:46895747-46895769 GGCTCTGTGCTGGTACATGGTGG + Intergenic
1151184383 17:72352450-72352472 TACTGTGAGTTGGGAGATGGGGG - Intergenic
1152848807 17:82619269-82619291 AACTGTGTGCTGGCAGTTGGAGG - Intronic
1156515510 18:37676113-37676135 TTATGTGTGCAGGCAGATGGTGG + Intergenic
1157395774 18:47339737-47339759 CAATGTGTGCTGGGAGATGTGGG + Intergenic
1159085423 18:63784173-63784195 TACTGTGTGCTGGTAGATGGCGG + Intronic
1160589301 18:79933745-79933767 TTCTGTGTGTGGGGAGATGGGGG - Intronic
1160857594 19:1224377-1224399 TAGGGTGTGCTGGGAGGTGGGGG + Intronic
1165070950 19:33254545-33254567 TAGTCTGTGCTGGTAGAGAGAGG + Intergenic
1167163499 19:47782401-47782423 TACAGTGTGTTGGGAGCTGGTGG - Intronic
1167235126 19:48309594-48309616 TACTGTGTCCAGGAAGAAGGAGG - Intronic
1167533354 19:50032786-50032808 CCCTGTGTTCTGGCAGATGGTGG + Intronic
1168431718 19:56286904-56286926 TGGTGTGTGCTGGTAAATAGTGG - Intronic
925262706 2:2542377-2542399 TCCTGTGTCATGGGAGATGGTGG + Intergenic
926133701 2:10321796-10321818 TACTGCATGCCTGTAGATGGCGG + Intronic
926467258 2:13206214-13206236 TTCTGTGGTCTGGAAGATGGTGG - Intergenic
927835487 2:26394743-26394765 TACTGTATTATGTTAGATGGAGG - Exonic
929696136 2:44117394-44117416 TTCTTTTTGCTGATAGATGGTGG + Intergenic
931230690 2:60372125-60372147 TACTGTGAGCTTCTAGGTGGGGG - Intergenic
932429305 2:71664431-71664453 TACTGTGTGTACGTGGATGGGGG + Exonic
933031445 2:77333790-77333812 TTCTGGGTTCTGGAAGATGGTGG - Intronic
933243344 2:79947682-79947704 TACTGGGTGCAGGGAGATGAGGG + Intronic
933565227 2:83942322-83942344 TGCTGCCTCCTGGTAGATGGGGG + Intergenic
934611878 2:95745161-95745183 CAATCTGTGCTGGGAGATGGTGG + Intergenic
935059941 2:99598569-99598591 TTCTGAGTGCTGGGACATGGTGG + Intronic
935339300 2:102045722-102045744 TGCTGTGTGCTTGTGGATGTAGG + Intergenic
938228321 2:129636617-129636639 TTCAGTGTGCTGGTATTTGGAGG - Intergenic
940465139 2:154018339-154018361 TACTGTGTCCAGGTAGCTGGAGG - Intronic
940794386 2:158061629-158061651 TACTGTCTGTTGGCAGATGTAGG - Intronic
940882592 2:158961553-158961575 GACTGTGTGCTGGAGGAGGGAGG - Intergenic
941599562 2:167524683-167524705 TACTGTCTGATGGCAGATCGAGG - Intergenic
943281847 2:185944845-185944867 TACTGGTTGTTAGTAGATGGGGG + Intergenic
943603451 2:189949078-189949100 TGCTGTCTGCTGGGAGGTGGGGG - Intronic
945333248 2:208562931-208562953 TTCTGTGTTCTGGAGGATGGTGG + Intronic
946222357 2:218239034-218239056 TACTGAGAGCTGACAGATGGTGG + Intronic
946252260 2:218420906-218420928 TACTATGTGCTAGGAGCTGGGGG + Intronic
946700894 2:222411980-222412002 CATTGTGAGATGGTAGATGGTGG + Intergenic
947312462 2:228819009-228819031 TTCTGTGTGCTGGAATATGGAGG - Intergenic
948524244 2:238560427-238560449 TGTTGTGTGCTGGGAGAGGGAGG - Intergenic
1175271693 20:57738603-57738625 GAGTGAGTGCTGGTGGATGGGGG + Intergenic
1175536924 20:59721336-59721358 GATTCTGTGCTGGTAGGTGGCGG + Intronic
1175719128 20:61274716-61274738 TACTGTGTGCTGTTGTTTGGGGG + Intronic
1183414096 22:37672938-37672960 GACTGTTTGCTGTTGGATGGAGG - Intergenic
1184024756 22:41846988-41847010 TACTCTGGGCTGGGAGCTGGAGG - Intronic
950804448 3:15586845-15586867 TCCTGTGTTGTGTTAGATGGTGG - Intronic
952320537 3:32273670-32273692 TAGTGCGTGCTGGGAGAGGGAGG + Intronic
954386048 3:50244614-50244636 TACTGTGTGGTGGTAGAATGTGG + Intronic
956902468 3:73730836-73730858 TACTGGGGTGTGGTAGATGGCGG + Intergenic
960055064 3:113271131-113271153 TGCTGTGTGCTGTGAGATGCTGG - Intronic
961478410 3:127163478-127163500 TGCTGAGTGCTGGGGGATGGTGG + Intergenic
962059355 3:131909115-131909137 GAGTGTGTGCTCTTAGATGGAGG - Intronic
962086473 3:132196853-132196875 AAATGTGGGCAGGTAGATGGTGG - Intronic
962796828 3:138856592-138856614 TACTGTGGCCAGGGAGATGGAGG - Intergenic
965933584 3:174077964-174077986 TACTGTTTCCTGGGAGGTGGGGG + Intronic
967330238 3:188282800-188282822 AACTGTGTGATGGGAAATGGAGG - Intronic
968747007 4:2365371-2365393 TGCTGCGTGCAGGTAGTTGGGGG - Intronic
972324695 4:38004342-38004364 TAGTGTGTGCAGGTTGAGGGAGG - Intronic
974248920 4:59360050-59360072 TTCTGTGGTCTGGAAGATGGTGG - Intergenic
974652168 4:64768219-64768241 TACTTTGTGCTGTTGGAAGGAGG + Intergenic
975897365 4:79108941-79108963 TAGTGTGTGTTGGTTGATGTTGG + Intergenic
976217574 4:82729481-82729503 AGCTGTGTGCTGGGAGATGCCGG - Intronic
978384309 4:108166116-108166138 TACTGTGTGCTGGGAAAAGGAGG - Intronic
980264043 4:130492618-130492640 TTCTGTGGTCTGGAAGATGGTGG - Intergenic
982678252 4:158400514-158400536 ATCTGGGTGGTGGTAGATGGGGG - Intronic
986001731 5:3635665-3635687 TACTGTGTTCTCGTAGGTCGGGG - Intergenic
989467752 5:41776672-41776694 TACTCTGTTCTGGTAAATGTTGG - Intronic
993098223 5:83505649-83505671 TTCTGGGTTCTGGAAGATGGTGG + Intronic
993398980 5:87425558-87425580 TGCTGTGGGGTGGAAGATGGTGG - Intergenic
993531108 5:89026843-89026865 TTCTGGGTTCTGGAAGATGGTGG + Intergenic
997775645 5:136601983-136602005 TCCTGGGGGCTGGAAGATGGTGG - Intergenic
999268797 5:150284467-150284489 CACTGTGTGCTTGTGGAGGGAGG + Intronic
1000040037 5:157478706-157478728 TACTGTGAACTGGAAGATGGTGG - Exonic
1000317673 5:160108751-160108773 TACTGTGTGTGTGTACATGGGGG - Intronic
1004299385 6:14443649-14443671 AACTGTGTGTTGGGATATGGGGG - Intergenic
1005347971 6:24909192-24909214 TCCTGAGTGCTGGGAGATGGGGG + Intronic
1005777336 6:29149470-29149492 TACTGTGGCCTGGTGGAGGGTGG - Intergenic
1007144057 6:39609476-39609498 TACTGTGTACTGGCAGCTGTAGG - Intronic
1011032962 6:82942900-82942922 TTCTGTGGTCTGGTTGATGGTGG - Intronic
1011887523 6:92115649-92115671 TACTGTGAGATGGTAGAAGGTGG + Intergenic
1012839672 6:104314091-104314113 TACTGTCTGCTTTTAGAGGGCGG + Intergenic
1013650221 6:112187447-112187469 TACTTTGAGGAGGTAGATGGTGG + Exonic
1014698938 6:124658974-124658996 TACTGCCTCCTGGTAGAAGGAGG - Intronic
1015849823 6:137560315-137560337 GACTCTGTGCTGTTAGGTGGGGG - Intergenic
1018573773 6:165236894-165236916 TTCTGGGGTCTGGTAGATGGTGG - Intergenic
1020846857 7:13296284-13296306 TTCTGTGTCCTGGTTTATGGTGG + Intergenic
1023675266 7:42622192-42622214 TACTGTGAGATTTTAGATGGTGG + Intergenic
1026469914 7:70686377-70686399 TACTGTGTGATGGTGGAGAGAGG - Intronic
1026865764 7:73823102-73823124 TGCTGTGGGCTGGGTGATGGAGG - Intronic
1031610923 7:123826375-123826397 CACTGTGTACTGGTAGCTGATGG - Intergenic
1033512023 7:142068592-142068614 TACTCTGTCCTGGAAAATGGTGG + Intronic
1033727386 7:144133199-144133221 TATTGTGTGCTGCTATATAGCGG - Intergenic
1035413300 7:158663460-158663482 CACGGTGTGGTGGGAGATGGAGG + Intronic
1039424597 8:37475716-37475738 GACTGTGTGCAGGAGGATGGAGG + Intergenic
1041516888 8:58710485-58710507 TACTGTGTGCTGCTAGCTCAGGG + Intergenic
1041812283 8:61924737-61924759 TCCTGTGTGGTGGGATATGGTGG + Intergenic
1041931410 8:63291461-63291483 TAGTGAGTTCTGGGAGATGGGGG + Intergenic
1045442451 8:102227915-102227937 TGCTGTGTGATGGTATTTGGAGG - Intronic
1045758702 8:105576147-105576169 TACCGTGTGCTGTAAGATAGTGG - Intronic
1047644670 8:126857522-126857544 CCATGTGTGCTGATAGATGGAGG + Intergenic
1048292448 8:133191261-133191283 TACTGGGTCCTGCTACATGGGGG + Intronic
1048663316 8:136632260-136632282 CACTGTGAGCTTGGAGATGGAGG - Intergenic
1050120918 9:2306184-2306206 TACTGTCTGCTGTTAGAGGCAGG + Intergenic
1053118464 9:35526259-35526281 TACTGAGTTCTGGAAGATGCTGG + Intronic
1057506752 9:95640341-95640363 TACTTTATGATGGCAGATGGAGG + Intergenic
1059125978 9:111685412-111685434 TACTGTGAGATGGTAGCAGGTGG + Intergenic
1060976336 9:127767303-127767325 TACTGAGTGCTAGTGGATGAGGG + Intronic
1061335625 9:129932813-129932835 TACTGTGTGTTGGAAGGGGGTGG - Intronic
1188143665 X:26583938-26583960 CACTGTGTACTACTAGATGGGGG - Intergenic
1190876857 X:54466150-54466172 AACTGTGTGCTGGGTGATGCTGG + Intronic
1192335653 X:70217185-70217207 TTCTGTGGGCTGGAGGATGGTGG - Intergenic
1194042773 X:88962515-88962537 TTCTGGGGGCTGGAAGATGGTGG - Intergenic
1194043301 X:88970391-88970413 TTCTGTGGTCTGGAAGATGGTGG + Intergenic
1194411229 X:93561053-93561075 TAGTGTGTGCCAATAGATGGAGG + Intergenic
1196598428 X:117571810-117571832 TACTGTGAGCTGCTATATGGCGG - Intergenic
1198522061 X:137463048-137463070 GACTCTGTGCTGGCAGACGGGGG - Intergenic
1200342136 X:155409004-155409026 TTCTGGGTGCTGGAGGATGGTGG - Intergenic
1200712748 Y:6503576-6503598 TAGTTAATGCTGGTAGATGGTGG + Intergenic
1202096863 Y:21260377-21260399 TACTTTTTCTTGGTAGATGGGGG - Intergenic