ID: 1159087408

View in Genome Browser
Species Human (GRCh38)
Location 18:63809496-63809518
Sequence AGCGCAGTGAAAGGTGGGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159087400_1159087408 9 Left 1159087400 18:63809464-63809486 CCTCGGATTCCTGCAAGGATGTA No data
Right 1159087408 18:63809496-63809518 AGCGCAGTGAAAGGTGGGTTGGG No data
1159087403_1159087408 0 Left 1159087403 18:63809473-63809495 CCTGCAAGGATGTAGAGGGCATA No data
Right 1159087408 18:63809496-63809518 AGCGCAGTGAAAGGTGGGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159087408 Original CRISPR AGCGCAGTGAAAGGTGGGTT GGG Intergenic
No off target data available for this crispr