ID: 1159093832

View in Genome Browser
Species Human (GRCh38)
Location 18:63879432-63879454
Sequence GCGACCTACCTAAGATTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159093832 Original CRISPR GCGACCTACCTAAGATTACA TGG Intronic
903368650 1:22820139-22820161 GAGACCTAGCTAAGATCACACGG + Intronic
909774070 1:79462352-79462374 GCTATCTACCAAAGATTGCATGG - Intergenic
915063471 1:153205570-153205592 GCAACTTGCCTAAGGTTACAAGG - Intergenic
915871756 1:159568134-159568156 GCTAACTACATAAGACTACATGG + Intergenic
917769550 1:178262206-178262228 ACGACCTTCCTAACAATACAAGG - Intronic
923641560 1:235766605-235766627 GTAACTTACCTAAGATCACATGG - Intronic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1068012839 10:51476095-51476117 GCAACCCACCTAAGACTACCTGG - Intronic
1078562640 11:12386673-12386695 GAGATCTGTCTAAGATTACATGG - Intronic
1078854322 11:15194397-15194419 GTGCCCTACCCAAGATTCCATGG + Intronic
1084901236 11:72311492-72311514 GTGACCTGCTTAAGGTTACAGGG + Intronic
1091992019 12:4963049-4963071 GCAACCTGCCCAAGATCACACGG - Intergenic
1097245590 12:57605907-57605929 GCCACCTCCCTCAGATCACATGG - Intronic
1101210461 12:102530412-102530434 GTGACTTGCCTAAGATCACAAGG + Intergenic
1127960803 15:63888891-63888913 GAGACCTGCCCAAGGTTACATGG + Intergenic
1133730856 16:8577441-8577463 GGGACTTACCTAAGGTCACATGG - Intronic
1136065646 16:27756464-27756486 GTCACCTACCTAAGGTCACACGG + Intronic
1137829729 16:51532984-51533006 GTGACTTGCCTAAGATCACAGGG + Intergenic
1147403900 17:40197079-40197101 GCCACCTACCCAAGTTTTCAAGG + Intergenic
1153096640 18:1413946-1413968 GTGACCTACGTAAGATTATAGGG + Intergenic
1159093832 18:63879432-63879454 GCGACCTACCTAAGATTACATGG + Intronic
1164952355 19:32347325-32347347 GTGACTTACCCAAGGTTACATGG - Intronic
1166656262 19:44614215-44614237 GTCACCTACCCAAGATCACAGGG + Intronic
931529268 2:63195328-63195350 GTGACCTGCTTAAGATCACATGG - Intronic
934481634 2:94653125-94653147 GCCATCTACTAAAGATTACATGG + Intergenic
936694142 2:114927280-114927302 GAGACCTGCCTCAGATTACCTGG - Intronic
945282792 2:208051809-208051831 GCGACCTGCCAGAGATTGCATGG - Intergenic
948482795 2:238261049-238261071 GCGACCCGCCTAAGGCTACATGG + Intronic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1170335893 20:15269699-15269721 GCTACCTGCCCAAGATGACAAGG - Intronic
1172896580 20:38304510-38304532 GCGAGTTGCCTAAGATTGCAGGG + Intronic
1174580472 20:51567952-51567974 GTGACCTACCTAGAATAACAAGG - Intergenic
1175111900 20:56654335-56654357 CAGACCTACCTAAGTTTCCAAGG - Intergenic
1175805394 20:61825636-61825658 GTGACTTGCCCAAGATTACAAGG + Intronic
951273315 3:20654467-20654489 GTGATTTACCAAAGATTACAAGG + Intergenic
951343682 3:21520206-21520228 CAGACATACCTAAGACTACATGG - Intronic
955443641 3:58983843-58983865 GTAACCTACCTAGGATCACATGG + Intronic
955776012 3:62433799-62433821 GAGACGCACCTAAGATTTCAAGG - Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
998135467 5:139671928-139671950 GCCACCTGCCTAAGGTCACAAGG - Intronic
1000274779 5:159724433-159724455 GCGACTTACCTAAGGTCACATGG + Intergenic
1004518336 6:16339666-16339688 GTCACTTGCCTAAGATTACATGG + Intronic
1004999432 6:21225650-21225672 ACTACCTGCCTAAGATCACATGG + Intronic
1010198715 6:73264230-73264252 GCAACCTAGATAAGATTGCAAGG - Intronic
1039315263 8:36364736-36364758 GCAACTTCCCTAAGTTTACATGG - Intergenic
1040440784 8:47439600-47439622 GGTACCTACCTAAGATTTCTGGG + Intronic
1050803776 9:9648301-9648323 GGGACTTTCCTAATATTACAAGG + Intronic
1053306928 9:36991264-36991286 GTGACCTACCCAAGGTCACATGG + Intronic
1061006293 9:127930161-127930183 GTGACTTACCTAAGGTCACAAGG - Intronic
1187677515 X:21732472-21732494 GTAAGCTCCCTAAGATTACAAGG + Intronic
1187683358 X:21791683-21791705 GCGTTCTACCTAAGATCTCATGG - Intergenic
1188295941 X:28448343-28448365 GGGACCTAGCTAAAATTGCATGG - Intergenic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1197714050 X:129693529-129693551 GTGACCTGCCTAAGGTCACACGG - Intergenic