ID: 1159100504

View in Genome Browser
Species Human (GRCh38)
Location 18:63952814-63952836
Sequence ATGTTTTTATAAATGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 5, 3: 86, 4: 593}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159100504_1159100507 6 Left 1159100504 18:63952814-63952836 CCTTCCTCCATTTATAAAAACAT 0: 1
1: 0
2: 5
3: 86
4: 593
Right 1159100507 18:63952843-63952865 AAGTTACATTCTGAAAATATTGG 0: 1
1: 0
2: 2
3: 40
4: 420

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159100504 Original CRISPR ATGTTTTTATAAATGGAGGA AGG (reversed) Intronic
900075424 1:812377-812399 ATGTTGGTGGAAATGGAGGATGG + Intergenic
900332266 1:2141794-2141816 ATGGTTTTAGAAATGGAAGCTGG + Intronic
900492325 1:2957357-2957379 ATGTTTATATAAATAATGGAGGG + Intergenic
903196373 1:21691685-21691707 ATGTTTTTACAAATTCAGAAAGG + Intronic
903705495 1:25282614-25282636 ATGTTTTTCAAAAAGGTGGAAGG - Intronic
903721736 1:25410706-25410728 ATGTTTTTCGAAAAGGTGGAAGG + Intronic
905878290 1:41447550-41447572 ATGTTCTTAAAAATGGAGATGGG + Intergenic
906433260 1:45773336-45773358 TTTTTTTTTTAAATGGAGTAAGG - Intergenic
907571379 1:55487319-55487341 ATGTTTCTATACCTGGAGGAAGG - Intergenic
907838910 1:58137605-58137627 ATGGTTGAATAAATGGGGGATGG - Intronic
907893865 1:58665157-58665179 ATTTTTTTATAAATGCAGACTGG - Intronic
908089657 1:60672380-60672402 ATATCTATATGAATGGAGGAAGG + Intergenic
908851206 1:68378065-68378087 ATGTTATTGGAACTGGAGGAAGG + Intergenic
909168300 1:72257538-72257560 ATCTTTAAATATATGGAGGAGGG - Intronic
909556891 1:76963970-76963992 ATGTTTTTGAAGATAGAGGAGGG + Intronic
909762752 1:79313046-79313068 TTTCTTTTTTAAATGGAGGATGG - Intergenic
909795299 1:79728012-79728034 ATGTTTTTATAAGTGAATGAAGG + Intergenic
909797751 1:79764355-79764377 ATGCTTTTATAACTGGAGATTGG - Intergenic
910014593 1:82506117-82506139 ATGTTTTTATTAATGTAGTTAGG - Intergenic
910633250 1:89379147-89379169 AAGCTTTTATTAATGGTGGAAGG + Intronic
911324485 1:96453765-96453787 ATTTCTTTCTAAATGGAGGGAGG + Intergenic
911351233 1:96758359-96758381 CTGTCTTTGAAAATGGAGGAGGG + Intronic
911371462 1:96999430-96999452 CTGTATTTATAAATGCAGTACGG - Intergenic
911717828 1:101155079-101155101 TTGTTTTTATATGTGGATGAGGG + Intergenic
911741428 1:101390160-101390182 ATGTTTGTACACATGGAGGAGGG + Intergenic
913010609 1:114679578-114679600 AGATTTTTATAACTGCAGGAAGG - Exonic
913024756 1:114826390-114826412 AAAATTTTAGAAATGGAGGACGG + Intergenic
913438624 1:118873482-118873504 ATTATTTTATAGATGAAGGAAGG + Intergenic
915561061 1:156688356-156688378 ATGTTTTTAAAAATAGAGATAGG + Intergenic
915988194 1:160487483-160487505 TTTTTCTTAAAAATGGAGGAAGG - Intronic
917226656 1:172790787-172790809 ATGTGGGGATAAATGGAGGAGGG + Intergenic
917369769 1:174279819-174279841 ATTTTTTTAAAAAAGAAGGATGG - Intronic
918677247 1:187302701-187302723 ATGTTTTTATACATGGTACAAGG + Intergenic
918772247 1:188576227-188576249 ATGTTTTTAGAAAGTGAGTAGGG - Intergenic
918926233 1:190790644-190790666 ATGATTCTATAATTAGAGGAGGG - Intergenic
919214924 1:194540947-194540969 CTGCTTTTATAAATGAAGTAAGG - Intergenic
919489629 1:198189915-198189937 ATATTTTTAAAAAGAGAGGAGGG + Intronic
919490643 1:198201123-198201145 TTGTTTTTTTAAGTGGAAGAGGG + Intronic
920189960 1:204187419-204187441 ATGTCTTTTAAAATGGAAGATGG + Intergenic
920514253 1:206572812-206572834 GGGTTTTTTTTAATGGAGGAAGG + Intronic
920580101 1:207098427-207098449 ACATTTTTATAAATGGAAGTTGG + Intronic
922271268 1:224037251-224037273 ATGTTGGTGGAAATGGAGGATGG + Intergenic
922327372 1:224540972-224540994 ATGGTATTATAAATGCAGGTGGG + Intronic
923133447 1:231097011-231097033 ATGTTCTTATAAAGTCAGGAAGG + Intergenic
923907558 1:238402267-238402289 ATATTTTTACAAATGAAGAAAGG + Intergenic
924024490 1:239818231-239818253 GTGTTTTTGTAAAAGAAGGAAGG - Intronic
924039708 1:239972392-239972414 AGATGTTTATAGATGGAGGAAGG + Intergenic
924706181 1:246504122-246504144 TTGTTTTTGTTAATGGAGAAAGG - Intronic
1063005628 10:1967981-1968003 CTCATTTTATAAATGGAGAAAGG + Intergenic
1063181962 10:3610633-3610655 TTGGTTTTATAAAAGGAGGGAGG - Intergenic
1063303054 10:4870221-4870243 ATTCTATTATAAATGGGGGAGGG - Intergenic
1063960833 10:11304309-11304331 GGGTTTTTGTAAATGGAAGAAGG - Intronic
1064331046 10:14394537-14394559 AGAATTTTAAAAATGGAGGAAGG + Intronic
1064416311 10:15153250-15153272 ATTTTTTTAGAGATGGCGGAGGG - Intronic
1064559311 10:16580288-16580310 ATCTTTGTATAAGAGGAGGAGGG + Intergenic
1064666411 10:17656661-17656683 ATGTTTTTGTAATCGGTGGAAGG + Intronic
1065011571 10:21425663-21425685 ATTTTTTTTTAAGTGGAGGCAGG - Intergenic
1065389792 10:25171436-25171458 ATGCTTATATAATTGGGGGAGGG + Intergenic
1065444274 10:25781394-25781416 ATGTCTTTATTAATGGCGTAGGG + Intergenic
1066634940 10:37491011-37491033 ATATTTTTATAAATAGAGATGGG - Intergenic
1068329152 10:55538687-55538709 ATGTTTTAATGAAAGAAGGAAGG - Intronic
1068566602 10:58582769-58582791 CTGGCTTTAAAAATGGAGGAAGG - Intronic
1068939782 10:62669518-62669540 ATGTCCTTATAAAAAGAGGAAGG - Intronic
1068978626 10:63037494-63037516 ATTATGTTATAAATGGAAGAGGG + Intergenic
1069250836 10:66264786-66264808 ATGTTATTGGAAATGGAGGATGG - Intronic
1069965902 10:72116225-72116247 AGGTTTTTAAAAAAGAAGGAAGG - Intronic
1070333192 10:75432192-75432214 ACTTATTTGTAAATGGAGGAAGG + Intronic
1071167062 10:82818810-82818832 ATGTTTTTCTAAATGGCAGGTGG - Intronic
1071266508 10:83969324-83969346 ATGTTTTGATAAATGCAACATGG + Intergenic
1071380255 10:85052396-85052418 ATGTTTTTACAAAGGGAGATTGG + Intergenic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1071687697 10:87778263-87778285 ATTTTTTTTTGAATAGAGGAGGG - Intronic
1073106582 10:101035834-101035856 GTGTTTGTATAAATGGGGGTGGG + Intronic
1073996450 10:109321220-109321242 ATTCTATTATAAATGGAAGAAGG - Intergenic
1074168257 10:110905888-110905910 TTCTTTTTATTAATGGATGATGG - Intronic
1074319738 10:112391075-112391097 ATTTTTTTAAAAATTGAGGAAGG + Intronic
1074832305 10:117257503-117257525 ATGGTTTTATCAATGAAGAAAGG - Intronic
1075137953 10:119803212-119803234 ATGCTTCTATAAATGTAGGTTGG - Intronic
1075898073 10:126015278-126015300 ATCCTCTTATAATTGGAGGAAGG + Exonic
1075900197 10:126036865-126036887 CTGTTTTTAGAAAGAGAGGAAGG - Intronic
1075902090 10:126051386-126051408 ATGGGTATATAAATGGATGATGG - Intronic
1076079892 10:127569895-127569917 ATGTTCTCAGACATGGAGGAAGG + Intergenic
1078221697 11:9356675-9356697 CTGTTTTTAAAAAAGGAGGGAGG + Intergenic
1079694241 11:23459206-23459228 AAGTTTTTATACTTGGAGAAAGG + Intergenic
1080231186 11:30018455-30018477 TTTTTTTTTTAAATGGAGGTGGG - Intergenic
1081415281 11:42807507-42807529 ATCTTTTTATAAATGGGGGGAGG + Intergenic
1084464710 11:69315494-69315516 ATGGTTGGATAAATGGATGATGG + Intronic
1084789721 11:71466134-71466156 AGGTTTTTAAAAATTGAGAATGG + Intronic
1084913057 11:72406861-72406883 ATGTATTTATAAAAGAAGGAAGG - Intronic
1085331061 11:75651515-75651537 ATTTTTTAAAAAATGGACGAGGG - Intronic
1085874822 11:80393587-80393609 ATCTTTTTATGATTGGAGGAAGG + Intergenic
1086393603 11:86391215-86391237 TTTTTTTTAAAAATGGAGGGTGG + Intronic
1087917447 11:103827503-103827525 AGATTTTTAAAAAAGGAGGAGGG + Intergenic
1088015735 11:105057179-105057201 CTGTTTTTCTGAATAGAGGAAGG - Intronic
1088884398 11:113995637-113995659 AGGTTTTTATAAAGGAAAGATGG - Intergenic
1089290065 11:117432255-117432277 GTTTTTTTTTAAAGGGAGGAGGG - Intronic
1089689178 11:120176189-120176211 ATGTTTCAATAAATGACGGATGG + Intronic
1089917591 11:122173446-122173468 ATGTTTTTGTAAAACAAGGAGGG + Intergenic
1090036466 11:123253668-123253690 ATGTTTTTATAAAAGGAAGGAGG + Intergenic
1090814266 11:130277390-130277412 ATGCTACTATAAATGGGGGAGGG - Intronic
1091993404 12:4974190-4974212 ATGTTTATAGAAATGGAAGAAGG - Intergenic
1092096425 12:5846234-5846256 ACGTTGTTATGAATGGTGGAAGG - Intronic
1092330489 12:7582706-7582728 ATGTTTTTAAAAAGGGTGGGGGG + Intergenic
1092934179 12:13345131-13345153 ATGTTTATAGAAATAAAGGATGG - Intergenic
1093012187 12:14119136-14119158 ATTATATTATAAATGGATGAAGG + Intergenic
1093429320 12:19066080-19066102 ATGTTATTTTAAATGGAGTGTGG + Intergenic
1093825474 12:23680563-23680585 AAATTTTTTTAAATGGAGGAAGG + Intronic
1094725785 12:33114354-33114376 CTGTTTTTAAAAATGGTAGATGG - Intergenic
1095220456 12:39607708-39607730 TTGTTTTTATATCTAGAGGATGG - Exonic
1095377920 12:41553417-41553439 ATGTTTTTAAAAATTAAGGCTGG + Intronic
1096031659 12:48421532-48421554 TTTTTTTTTTAGATGGAGGATGG + Intergenic
1096356709 12:50947437-50947459 CTGACTTTAAAAATGGAGGAAGG - Intergenic
1096705315 12:53417585-53417607 AGGTTTTTTAAAATGGGGGAAGG - Intergenic
1098369410 12:69740043-69740065 ATGATTGCATAATTGGAGGAGGG + Intronic
1098426579 12:70371191-70371213 AGGTTTTTATTATTAGAGGAAGG - Intronic
1098881668 12:75923808-75923830 AGGTTGTTATAAATGGAAAATGG - Intergenic
1099473741 12:83082769-83082791 ATGTCTCTATAAATTTAGGAAGG - Intronic
1099507243 12:83494259-83494281 ATGTTGTTATAAAAGGTAGAAGG + Intergenic
1099933701 12:89101423-89101445 ATATCTTTTTAAATGGAGGAAGG + Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100489226 12:95062976-95062998 ATGTTTGTCTAAATGGAACATGG - Intronic
1100729938 12:97453790-97453812 ATGTTTGAAGAAATGGAGGGAGG - Intergenic
1100878103 12:98984617-98984639 ATATTATTAGAAATGCAGGAAGG - Intronic
1101073445 12:101101183-101101205 AGGGTGTTATAAATGGAAGAGGG - Intronic
1102015160 12:109643394-109643416 ATTTTTTTTTAAATGGAGATGGG - Intergenic
1102275021 12:111575338-111575360 ATTTTTTAATTAATGGGGGATGG - Intronic
1102425106 12:112837918-112837940 AAGTGTTTATTAATAGAGGAAGG - Intronic
1103189109 12:118985479-118985501 ATGTCTTTAAAAATGAAAGAAGG + Intronic
1104476579 12:129075341-129075363 GTGTTGTTATAAAAGGAAGATGG + Intronic
1105622493 13:22082308-22082330 ATGTTTATATGAATAGAGGAAGG + Intergenic
1105970288 13:25423205-25423227 ATTTTTTTAAAAATGAAGGAAGG - Intronic
1106693230 13:32142547-32142569 AGGATTTTATAAATGAGGGAAGG - Intronic
1107107515 13:36661182-36661204 ATGTATTTTTAAATGGATGATGG - Intergenic
1107444324 13:40456982-40457004 ATGTCTTTATAGAAGGAAGAGGG + Intergenic
1107597370 13:41976805-41976827 ATATTTTTATAACTGGGGGTAGG + Intergenic
1108550091 13:51535480-51535502 ATGTCTTTATAAAAGTAAGAGGG + Intergenic
1109329341 13:60908798-60908820 ATTTATTTTTAAATAGAGGAGGG - Intergenic
1109967997 13:69726612-69726634 ATGTTTTAATAAATAAAGGTAGG - Intronic
1110162111 13:72390867-72390889 TTGTTTTTAGAATTGGGGGAGGG - Intergenic
1110528074 13:76562989-76563011 ATCTTTTTTTTGATGGAGGAAGG - Intergenic
1110581578 13:77135801-77135823 ATGTGTTTACCATTGGAGGAAGG - Intronic
1111341142 13:86888002-86888024 ATCTTTTTAAAAAGGGTGGATGG + Intergenic
1111629927 13:90837545-90837567 ATGGGTTTGAAAATGGAGGAGGG - Intergenic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1112177891 13:97046250-97046272 ATGTTTTTATAATTGTAAAAAGG + Intergenic
1112938666 13:104832573-104832595 ATGTATTTGTCAAGGGAGGAGGG - Intergenic
1113130449 13:107030945-107030967 ATGATTGAATAAATGAAGGAAGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113609069 13:111630583-111630605 ATGTTTGGGTAAATGCAGGAAGG - Intronic
1114681817 14:24491252-24491274 ATATTTTTATAAATAAAGTAAGG - Intergenic
1114994385 14:28329984-28330006 AAGTTGTTAAAAATGAAGGATGG - Intergenic
1115749818 14:36477868-36477890 TTTATTTTATAGATGGAGGAGGG - Intronic
1115916849 14:38324743-38324765 ATGTTTTTATATATAGAAGTAGG + Intergenic
1116012654 14:39369076-39369098 ATATTTTTTTAAATGTAAGATGG + Intronic
1116543201 14:46126316-46126338 AAATTTTTATAAATGGAATAAGG - Intergenic
1116968314 14:51038242-51038264 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1117527287 14:56621768-56621790 ATCTTTTTTAAAATGGTGGACGG + Intronic
1117720956 14:58628266-58628288 ATGTTTGTTGAATTGGAGGAAGG - Intergenic
1117877753 14:60273347-60273369 TTGTTTATATATTTGGAGGAAGG + Intronic
1118396251 14:65339633-65339655 ATTTTTCAATAAATGGTGGATGG - Intergenic
1118914874 14:70094401-70094423 TTGGTTTTATAATTGAAGGATGG - Intronic
1120122960 14:80704676-80704698 ATTTTTTTATAAAATTAGGATGG + Intronic
1120605269 14:86568346-86568368 ATGTTGTTATAAATGTAGTTCGG - Intergenic
1120794251 14:88614785-88614807 AAGTTTTTACAAATGGAGTTGGG + Exonic
1120954843 14:90072786-90072808 ATGTTTATATGAATGCAGAATGG + Intronic
1121348590 14:93154785-93154807 ATGTTTTTAAAAAAGGAGCCAGG + Intergenic
1121403362 14:93702348-93702370 CTGTGTTTATAAATGGAGTATGG - Intronic
1121754949 14:96394444-96394466 ATTTTTTTTTTAATGGAGGAAGG + Intronic
1123067254 14:105624910-105624932 ATGGTTTTCTCGATGGAGGACGG + Intergenic
1123428547 15:20193743-20193765 ATGTTTATAGGGATGGAGGAAGG + Intergenic
1124611307 15:31211130-31211152 ATGTTTTTAAAAAGGGTGTATGG + Intergenic
1125053808 15:35334119-35334141 TTGTATTTAAAAATGGAAGAGGG + Intronic
1125220292 15:37324915-37324937 ATTTTTGTATATATGGAGTAAGG - Intergenic
1125397112 15:39261084-39261106 ATGTCTTTATAAGAAGAGGAAGG - Intergenic
1125652449 15:41328675-41328697 ATGTTTAAATAAATGTCGGAGGG + Intronic
1125813534 15:42563599-42563621 ATATTTCTATGAATGCAGGAAGG + Intronic
1126227211 15:46285031-46285053 ATATTTTTATATATGGTGAAAGG + Intergenic
1126318101 15:47392421-47392443 GTGTTTTTATAAATCAAAGAAGG + Intronic
1126325950 15:47477530-47477552 ATCATTTTATATTTGGAGGAAGG + Intronic
1126704917 15:51397683-51397705 TTGTTTTAATAGAGGGAGGAGGG + Intronic
1126739964 15:51767778-51767800 TTGTTTTTTTAAATTAAGGAAGG + Intronic
1126838181 15:52688901-52688923 CTATTTTTACAGATGGAGGAAGG + Intronic
1127934472 15:63623620-63623642 ATGTTTTTATAAATGTAGCAAGG - Intronic
1130685477 15:86033417-86033439 ATCTTTTTAAAAATTGAGGCCGG + Intergenic
1130846639 15:87753809-87753831 ATTTTTTTTTAAATGGAGTCTGG + Intergenic
1131067884 15:89445586-89445608 ATGTATATATCAATGGAAGAAGG - Intergenic
1131432203 15:92395831-92395853 ATGTTTTTATAACAGGACAATGG - Intronic
1131575302 15:93583857-93583879 TTGTTTGTCTAAATGGAGAAGGG - Intergenic
1133652441 16:7825401-7825423 ATTTATATATATATGGAGGAAGG - Intergenic
1133850044 16:9494828-9494850 ATGTTTTGATTAAGGAAGGAAGG + Intergenic
1134186460 16:12088772-12088794 ATGTTTTTATTTGTAGAGGAAGG - Intronic
1134534775 16:15017244-15017266 CAGTTTTTATGAATGGAGGAGGG + Intronic
1134819177 16:17231934-17231956 ATTTTTTTATAAATTGAGTGTGG - Intronic
1135132095 16:19861624-19861646 ATGGTTTTCTAAATAGAGGTGGG + Intronic
1135671213 16:24377117-24377139 ATGTCTTTAAAAATGGTGGTGGG - Intergenic
1137264904 16:46860689-46860711 ATTTTTGTACAAATGGAGAATGG + Intergenic
1137320384 16:47374753-47374775 TTGTTTTTTTAAATGGGGCAAGG - Intronic
1138101662 16:54256776-54256798 ATTTTTTTAAAAATTGAGGCAGG + Intronic
1138170702 16:54846677-54846699 AAATTTTTAGAAATGGAAGAAGG + Intergenic
1138766777 16:59614466-59614488 TTATTTTTATAAATGGATGTTGG + Intergenic
1138813336 16:60176166-60176188 ATGTTGTTACTAATGGAAGAAGG - Intergenic
1139445119 16:66992991-66993013 CGGTTTTGATAAAAGGAGGAGGG + Intronic
1139861265 16:70023532-70023554 CAGTTTTTATGAATGGAGGAGGG - Intergenic
1140558445 16:75948259-75948281 CTGTCTTTAGAGATGGAGGAAGG + Intergenic
1141591836 16:85074273-85074295 ATGTATATATAAATGGAATATGG - Intronic
1143738171 17:8928961-8928983 ATCATATTATAAATGGAGGCAGG + Intronic
1143740797 17:8952626-8952648 ATATTTTTATAAATGAATTAGGG + Intronic
1144311222 17:14015977-14015999 ATGTTTTTAGAGTTGCAGGAAGG - Intergenic
1145193769 17:20869177-20869199 GTGTTTTGATAGATGGAGGGGGG + Intronic
1145298258 17:21611962-21611984 GTGTTTTGATAGATGGAGGGGGG - Intergenic
1145351992 17:22091404-22091426 GTGTTTTGATAGATGGAGGGGGG + Intergenic
1146066827 17:29642596-29642618 CTGTTTTTATAGATGGGGGATGG - Intronic
1146086217 17:29832442-29832464 ATGTTTGAATAAATGAATGATGG + Intronic
1146711643 17:35047187-35047209 ATTTTTTTTTAAATGAAGGCAGG + Intronic
1147058524 17:37854039-37854061 ATGTTAATATAACTAGAGGAAGG - Intergenic
1147459090 17:40557212-40557234 GTGATTTTATCAATGAAGGAGGG + Intronic
1147499440 17:40948677-40948699 ATGTCTTTAAAAGTGGAAGAGGG + Intergenic
1147666064 17:42149010-42149032 CTGTTCTTATACATAGAGGATGG + Intronic
1148574369 17:48699060-48699082 ATCATATTATAAATGGAGGCTGG - Intergenic
1148939629 17:51197104-51197126 ATATATATATATATGGAGGACGG + Intronic
1149940210 17:60856239-60856261 AGTTTTTTATTAATGGAAGAAGG + Intronic
1150021384 17:61617437-61617459 TTGTTTTAATAAAAGGAGAAAGG + Intergenic
1150310576 17:64125799-64125821 ATGTTTTTTTACATGGATGATGG + Intronic
1151312696 17:73303691-73303713 ATGTTTTTAAAACTAAAGGAAGG - Intronic
1151653507 17:75484724-75484746 ATCTTTTTTTAAATGGAGAGAGG - Intronic
1152171612 17:78753702-78753724 GTGTTTTCATAATTGGAGTATGG - Intronic
1153569406 18:6453708-6453730 ATTTTTTTAAAAATAGAGGCAGG - Intergenic
1153667623 18:7380457-7380479 ATGTTTTTATAAAACAAGCAAGG + Intergenic
1153877687 18:9389682-9389704 CTGTTTTTATAAATTCAGGGAGG - Intronic
1153990383 18:10393692-10393714 ATTATATTACAAATGGAGGAGGG + Intergenic
1154342345 18:13514413-13514435 TTAGCTTTATAAATGGAGGAAGG - Intronic
1155870582 18:31022266-31022288 AAGTTATAATAAATGGGGGAGGG + Intronic
1155947583 18:31873349-31873371 ATCGTTTTTTAAATGGAGAAAGG + Intronic
1156097315 18:33551250-33551272 AATTTATTATAAATGGGGGAGGG + Intergenic
1156109095 18:33702110-33702132 ATGTTTACATAAATTAAGGAAGG - Intronic
1157254213 18:46123909-46123931 TTGTTTTTATAAATAGAGATGGG + Intronic
1157596275 18:48865811-48865833 TTTTTTTTTTAAATGGAAGAAGG - Intergenic
1157637187 18:49170174-49170196 ATCTATTTATAAAAGGGGGAGGG - Intronic
1157914106 18:51647706-51647728 ACTTTTTTATTGATGGAGGATGG - Intergenic
1158028344 18:52930713-52930735 ATGTTTCAATAAATGTATGAAGG - Intronic
1158218565 18:55126411-55126433 AGGTTTTTATAAATGGACTCAGG - Intergenic
1158426558 18:57345368-57345390 ATGTGCTTATAATTGGAGCAGGG + Intergenic
1158495535 18:57951979-57952001 CTGGTTTTATACATGGAAGAGGG - Intergenic
1158624703 18:59061145-59061167 ATTTTCTTCTCAATGGAGGAAGG + Intergenic
1158707952 18:59810940-59810962 AAGTTTTGATAAATGGCAGAAGG + Intergenic
1159100504 18:63952814-63952836 ATGTTTTTATAAATGGAGGAAGG - Intronic
1159540615 18:69770101-69770123 GCGTTTTTATAAATGGAGAGAGG + Intronic
1159746876 18:72247369-72247391 CTGTTTATGCAAATGGAGGATGG + Intergenic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162900103 19:13790038-13790060 AAATTTTTAGAAATGGGGGAGGG + Intergenic
1163529297 19:17840454-17840476 CTGATTTTATAAATGGGGGGAGG - Intronic
1163879060 19:19901655-19901677 ATGTTTTGAGAAAAGGAGAATGG - Intronic
1164595913 19:29530503-29530525 GTGCATTTATGAATGGAGGAGGG + Intronic
1164942208 19:32259465-32259487 ATGTATTTTTTAATGGAGCATGG + Intergenic
1167083593 19:47293963-47293985 ATTTTTTTTTAAATGTAGGCTGG - Intronic
1168569051 19:57449394-57449416 TTGTTTTAGTAAATGGAGGAAGG + Intronic
925368577 2:3327481-3327503 ATTTTTTTAAAAATGGAAAAGGG - Intronic
927223188 2:20734572-20734594 ACGATTTTATAAATGGGGGAGGG - Intronic
927742863 2:25588306-25588328 ATGTTGTTATAAATGCAGAAAGG - Intronic
928258463 2:29745429-29745451 ATTTTATTATATATGGTGGAGGG - Intronic
929185158 2:39086392-39086414 ATGTTTTCATAAGTGGGAGAGGG + Intronic
929396087 2:41524130-41524152 ATGTTTTTAAACATGGAAGAGGG + Intergenic
929434611 2:41918944-41918966 TTGTTGGTATAGATGGAGGATGG + Intergenic
930522343 2:52483172-52483194 ATGTGATTATAAATACAGGAAGG - Intergenic
930719338 2:54624145-54624167 ATTTTTTTTTTAATGGAGGCAGG + Intronic
930840418 2:55839219-55839241 AGCTTTTTATAAATGTAGGGAGG - Intergenic
931062341 2:58545420-58545442 ATCTCTTTATACCTGGAGGAGGG - Intergenic
931395134 2:61881106-61881128 ATCTTTTCATAACTGGTGGATGG + Intronic
931550586 2:63441394-63441416 ATGTTTTGAATAAAGGAGGAAGG - Intronic
931895962 2:66729927-66729949 TTTTCTTTATAGATGGAGGAGGG + Intergenic
932110656 2:68996166-68996188 ATGTTTAGATAAGTGGATGATGG - Intergenic
932842025 2:75092262-75092284 AGGTTTTTAAAATTGGGGGAGGG - Intronic
932894785 2:75629265-75629287 ATGTTTCTATAAATGGTTCAAGG + Intergenic
933018131 2:77157242-77157264 CAGTTTTTATAAATGGGGAAGGG + Intronic
933168429 2:79098789-79098811 CTGTTTTTTGGAATGGAGGATGG + Intergenic
934737437 2:96696899-96696921 ATTTTTTTTTAAGTGGGGGATGG - Intergenic
934802708 2:97182076-97182098 ATGTTTTCACCAAGGGAGGAAGG + Intronic
934833491 2:97558494-97558516 ATGTTTTCACCAAGGGAGGAAGG - Intronic
934991093 2:98921950-98921972 TTGTTTTTTTAAGTGGAGCAAGG - Intronic
935543705 2:104378534-104378556 AGGTTTTTATAAGTCCAGGATGG + Intergenic
936442867 2:112570697-112570719 ATGTTTTAGTCAATGCAGGATGG - Intronic
936485471 2:112921832-112921854 AGATTTTTATAAATGAAGAAAGG + Intergenic
936553105 2:113467760-113467782 AGGTTTTTACAGATGGAGTAGGG + Intronic
936756046 2:115713876-115713898 CTGGCTTTATAAATGGATGATGG - Intronic
937396841 2:121544543-121544565 ATGTTTTTTTAAAGGGGGAAAGG + Intronic
937611236 2:123864028-123864050 ATGATATTAGAAATGGAGAATGG + Intergenic
937945166 2:127327699-127327721 TTGTTTTTATAAAAGGGAGATGG - Intronic
938797980 2:134734734-134734756 GTGTTTTTGGAAAAGGAGGAGGG - Intergenic
939900775 2:147846601-147846623 ATGTCTGTTTAAATGGAAGAAGG + Intronic
940376154 2:152961269-152961291 ATGGTTTTATAAAATGAGAATGG + Intergenic
940778230 2:157906354-157906376 AGGATATTACAAATGGAGGATGG + Intronic
940863746 2:158796246-158796268 ATGTTTTTGTAAATGGAGAAAGG - Intronic
941708692 2:168688319-168688341 AATTTTTTATCAATGGAGGCAGG + Intronic
941802157 2:169671858-169671880 ATGTTTGTATGAATGAATGAAGG + Intronic
941829423 2:169938127-169938149 ATACCTTTATAAATGGAGGTGGG - Intronic
942040034 2:172051633-172051655 ATGTTGTTATTATTGGAAGAGGG + Intronic
942106437 2:172638002-172638024 ATTTTTTTTTAAATGGAGTAGGG + Intergenic
942438644 2:176008214-176008236 ATGTTCTTACATATGGAGAAAGG + Intergenic
942538062 2:176986340-176986362 ATGTTTTTAAAAAGGGAGGCGGG + Intergenic
942628169 2:177925995-177926017 ATTTTTCTTCAAATGGAGGAAGG - Intronic
942644853 2:178099123-178099145 ATGTTTTTAAAAATACAGTACGG + Intronic
942981571 2:182089583-182089605 ATCTTTTTATAAATGCAAGCAGG + Intronic
943129113 2:183835721-183835743 ATGTATTTATCATTGGATGAAGG - Intergenic
943659302 2:190540766-190540788 CTCTTTTTAAAAATTGAGGAGGG - Intergenic
943879084 2:193115521-193115543 TTGTTATTATAAATGGAGAAAGG + Intergenic
944646573 2:201786316-201786338 ATGTTTGTATGCATGGAGGGAGG - Intergenic
944823028 2:203450515-203450537 ATTCTTCTATAAAAGGAGGAAGG + Intronic
945146802 2:206746958-206746980 ATGTGTTATTAAATGAAGGATGG - Intronic
945148481 2:206763556-206763578 AGGTTTTTAGAAGGGGAGGAGGG - Intronic
945514440 2:210745648-210745670 TTGCTTTTATAAAAGGAGGGTGG + Intergenic
945888376 2:215401414-215401436 ATCTTATTATAAATGTAGAAAGG + Intronic
947069349 2:226269463-226269485 ATGTGTTAATAGATGAAGGATGG - Intergenic
947827022 2:233113381-233113403 ATGTTTTTAAAAAAAGAGAAGGG + Intronic
947997248 2:234538633-234538655 ATGTTGTAATAAATGGAAGTGGG - Intergenic
948507462 2:238438982-238439004 ATATTTTTATGAGTGGATGAAGG + Intronic
1169670536 20:8095523-8095545 ATTTTTGTATAAATAGAGGGTGG + Intergenic
1169748449 20:8966662-8966684 ATGTTTATTTATATGGAAGAGGG - Intronic
1170276924 20:14601648-14601670 ATTTCTTTTTTAATGGAGGAAGG + Intronic
1170493164 20:16898836-16898858 ATGTTTATATAAATGGAGTTGGG - Intergenic
1170974196 20:21146720-21146742 TTGTTTTTATAGTAGGAGGAAGG + Intronic
1171222205 20:23408909-23408931 ATTTTTTTAAAAAGGTAGGAGGG + Intronic
1171354534 20:24534001-24534023 AGGTTTTTATTCATGGAAGAAGG + Intronic
1172356298 20:34282588-34282610 CTCATTTTATAAAAGGAGGATGG - Intronic
1172803882 20:37597684-37597706 ATGTTTGAATAAATGGAGGGAGG + Intergenic
1173066438 20:39717659-39717681 GTGATATTATTAATGGAGGAAGG - Intergenic
1173581363 20:44149084-44149106 TTTTTTTTTTAATTGGAGGAGGG - Intronic
1173713931 20:45184800-45184822 ATTTTTTAATAAGTAGAGGATGG + Intergenic
1174309915 20:49644255-49644277 ATGTTTTAATAAATAGAGACAGG + Intronic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1174596142 20:51685268-51685290 ATGTTTTCATAAAAACAGGATGG - Intronic
1175961549 20:62639567-62639589 ATTTTTTTATAAGTCAAGGAAGG + Intergenic
1176153653 20:63607034-63607056 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153660 20:63607067-63607089 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153667 20:63607100-63607122 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153677 20:63607168-63607190 ATGTTTCTGGAAATGGAGGTGGG - Intronic
1176153685 20:63607201-63607223 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153692 20:63607234-63607256 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153700 20:63607268-63607290 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153718 20:63607370-63607392 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153726 20:63607404-63607426 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153733 20:63607436-63607458 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153753 20:63607539-63607561 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153761 20:63607573-63607595 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153775 20:63607642-63607664 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153789 20:63607711-63607733 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153797 20:63607745-63607767 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153804 20:63607779-63607801 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153818 20:63607848-63607870 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153851 20:63608019-63608041 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153858 20:63608053-63608075 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153870 20:63608119-63608141 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153877 20:63608153-63608175 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153909 20:63608324-63608346 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153916 20:63608358-63608380 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153928 20:63608424-63608446 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153934 20:63608458-63608480 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153941 20:63608492-63608514 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153948 20:63608526-63608548 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153955 20:63608560-63608582 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153962 20:63608594-63608616 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153975 20:63608662-63608684 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153982 20:63608696-63608718 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176153989 20:63608730-63608752 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176153996 20:63608764-63608786 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154003 20:63608798-63608820 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154018 20:63608867-63608889 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154031 20:63608935-63608957 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154064 20:63609105-63609127 ATGTTTCTGGAAATGGAGGTGGG - Intronic
1176154088 20:63609243-63609265 ATGTTTCTGGAAATGGAGGTGGG - Intronic
1176154119 20:63609416-63609438 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154127 20:63609450-63609472 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154133 20:63609484-63609506 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154140 20:63609518-63609540 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154153 20:63609585-63609607 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154161 20:63609619-63609641 ATGTTTCTAGAAATGGATGTGGG - Intronic
1176154167 20:63609652-63609674 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154174 20:63609685-63609707 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154188 20:63609754-63609776 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154196 20:63609788-63609810 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154223 20:63609926-63609948 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1176154231 20:63609960-63609982 ATGTTTCTAGAAATGGAGGTGGG - Intronic
1177429388 21:20971168-20971190 ATGTTTTTTAAAATGGGGGAGGG + Intergenic
1177463220 21:21440245-21440267 ATGTTATTATAAGGGGAGGTTGG - Intronic
1177914273 21:27068879-27068901 CTGGCTTTAAAAATGGAGGAAGG + Intergenic
1178674474 21:34619214-34619236 TTTTTTTTTCAAATGGAGGAAGG + Intergenic
1179180921 21:39044337-39044359 AAGTGTTTATCAATGGATGAAGG - Intergenic
1179240079 21:39582122-39582144 GGGTTTTTAAAAGTGGAGGAGGG + Intronic
1179417692 21:41211413-41211435 TTGTTTTTATAAAGGGAGGGGGG - Intronic
1180923297 22:19534195-19534217 ATTATATTATAAATGGGGGAGGG + Intergenic
1181312782 22:21954419-21954441 ATAATTTTTTAAATGGAGGATGG + Intergenic
1181552288 22:23647341-23647363 ATGTTTTTTTAAGTGAAGCAAGG - Intergenic
1181611438 22:24015643-24015665 ATGTTTTTAAAAATTAATGAGGG - Intronic
1181959004 22:26609601-26609623 ACGTGTGTATAAATGGAGAATGG + Intronic
1183394533 22:37563688-37563710 ATGGTTTTAAAAAAGGAAGAAGG + Intronic
1183613864 22:38929963-38929985 TAGTTTTTATAAATGGTGTAAGG + Intergenic
1184943759 22:47786742-47786764 GTGTTTTTAAAAATTCAGGAAGG + Intergenic
949921876 3:9009426-9009448 CTTTTTTTTTGAATGGAGGAAGG - Intronic
950326711 3:12117193-12117215 ATCTTTTTATAAATCCATGAAGG - Intronic
950623416 3:14226110-14226132 ATGTTTCTGCAATTGGAGGAGGG - Intergenic
951118116 3:18889468-18889490 ATGATTTTTTAAATGTAGGCTGG - Intergenic
951281888 3:20760886-20760908 AAATTTTTAAAAATTGAGGAAGG + Intergenic
951977026 3:28522468-28522490 ATGGATTTATAAATGGACAAAGG + Intronic
951983312 3:28589579-28589601 ATCTTTTTAAGATTGGAGGAAGG + Intergenic
952550670 3:34472787-34472809 ATTTTTTTATAAGGTGAGGAAGG + Intergenic
952692457 3:36225951-36225973 ATGAATTTATAAAGGAAGGAAGG - Intergenic
952749220 3:36811703-36811725 ATTTTTTTAAAAAAGGAAGAGGG + Intergenic
953252267 3:41256578-41256600 ATGTAATTTTAAATGGATGATGG + Intronic
953642520 3:44722579-44722601 ATGTTTCCAGAAATGGAGGTGGG + Exonic
955023342 3:55142830-55142852 ATGTTTGTGTATATGGAGAATGG + Intergenic
955693556 3:61613676-61613698 ATGGTTATATAAATTGAAGATGG + Intronic
955897636 3:63717571-63717593 ATGTTCTTATGAATGGAAGAGGG - Intergenic
955904162 3:63789286-63789308 ATTTTTCCATGAATGGAGGAAGG - Intergenic
955974692 3:64468691-64468713 ATGTTTTTATAATTGGGGAGTGG - Intergenic
956387830 3:68739623-68739645 ATGTGTCCATCAATGGAGGACGG + Intronic
956553944 3:70496547-70496569 CTGTTTTTATAAAATAAGGAGGG - Intergenic
957197812 3:77093067-77093089 ATGTTTTTAAAAGAAGAGGAGGG - Intronic
957764154 3:84600028-84600050 TAGTTTTTATAAATGCAGTAAGG - Intergenic
957822390 3:85394428-85394450 ATGTTTGTATTATTGGAGCAGGG + Intronic
957828461 3:85483042-85483064 ATGTTTTGAGAAATGCAGAAAGG - Intronic
958542297 3:95494463-95494485 ATGTTTCTATAAATTCTGGAGGG - Intergenic
958667065 3:97154624-97154646 ATGTTTTTAAAGGTGGAGGAAGG - Intronic
959177001 3:102925732-102925754 ATGCCTTTGTAAATGTAGGAGGG + Intergenic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959988927 3:112608945-112608967 TTGTTTTTTAAAAGGGAGGAGGG - Intronic
960247411 3:115414712-115414734 ATGTTCACAGAAATGGAGGAAGG - Intergenic
960626258 3:119685139-119685161 AAGTTTTTATAGGTTGAGGATGG - Intergenic
962261637 3:133912905-133912927 ATGAATGTATAAATGGTGGATGG + Intergenic
962299274 3:134223557-134223579 TTGTTTATAAAAAGGGAGGAGGG + Intronic
962553114 3:136515908-136515930 AAGATTTTATATCTGGAGGAGGG + Intronic
962669778 3:137693221-137693243 ATGTTTTAAAAGATGGAGGCAGG + Intergenic
963008235 3:140746364-140746386 ATTTATTTTTAAATGAAGGAAGG + Intergenic
963262072 3:143202924-143202946 ACATTTTTATAAAGGGAAGAGGG - Intergenic
964217135 3:154298315-154298337 ATGTTTATAATAATGGGGGAAGG + Intronic
965034728 3:163423872-163423894 ATGTTTTTAAAAAAAGAAGAAGG + Intergenic
965472930 3:169117518-169117540 GGGTTTTCATAAATGCAGGAAGG - Intronic
965679814 3:171238182-171238204 GTTGTTTTATAAATGCAGGATGG + Intronic
965679924 3:171239719-171239741 GTTGTTTTATAAATGCAGGATGG + Intronic
966294243 3:178400329-178400351 AAGTTTTTACTCATGGAGGAAGG - Intergenic
966606769 3:181828817-181828839 ATGTTTTTAGAAATGGGGTCTGG + Intergenic
967835473 3:193959054-193959076 ATGTTCTTATAAAAAGAGGAAGG + Intergenic
970791281 4:19860837-19860859 AAGCTTTTATTAATGGTGGAAGG - Intergenic
970815722 4:20154087-20154109 ATGTTGCTTTAAATGGAGAAGGG - Intergenic
970817208 4:20170999-20171021 ATGTTTTTAAAAATTGTGAATGG - Intergenic
970938946 4:21608473-21608495 ATGCCTTTGAAAATGGAGGAAGG - Intronic
971663820 4:29456341-29456363 CTGTCTTTAAAGATGGAGGAAGG - Intergenic
971803328 4:31320786-31320808 ATGACTTTAAAAATAGAGGAAGG + Intergenic
972046484 4:34671421-34671443 ATATTTTTAAAAATGGAGATAGG + Intergenic
972181326 4:36470353-36470375 TTGTTTGTATAAAGAGAGGAAGG - Intergenic
973042019 4:45480414-45480436 AATTTTTAATAAATGGAGTAAGG - Intergenic
973272765 4:48278520-48278542 GGATATTTATAAATGGAGGAGGG + Intergenic
973603885 4:52567978-52568000 ATGTGTTTATAAATCTAGGGAGG + Intergenic
973887519 4:55337941-55337963 TTATTTTGATAAATGGAGTAAGG + Intergenic
974556060 4:63448989-63449011 ATGTGCTTATAAATGGATGCTGG + Intergenic
974776504 4:66490004-66490026 ATGTTTTTATAGTTGGGGAAGGG + Intergenic
974950107 4:68577009-68577031 CTGTTTTTTGGAATGGAGGATGG - Intronic
975280663 4:72558451-72558473 GAGTCTTTATAAATGGAAGAGGG - Intronic
975455338 4:74583908-74583930 ATGTTTTTCTAAATGGAAGTAGG - Intergenic
978580011 4:110222107-110222129 TTGTTTTTATAAATGATAGAAGG - Intergenic
978752665 4:112269605-112269627 ATGTTCTTATAAATATAGGAAGG + Exonic
978755264 4:112295001-112295023 ATGCGTTTTTAAATGGATGATGG - Intronic
979270122 4:118749660-118749682 ATATTTTTTTAAATGGGGGTGGG - Intronic
979741005 4:124150994-124151016 ATGGTCATATAAATGGAGAAAGG + Intergenic
979784475 4:124698281-124698303 ATGTAGATATAAATGCAGGAGGG + Intronic
980370253 4:131860574-131860596 CTCATTTTAGAAATGGAGGAAGG - Intergenic
980815042 4:137935023-137935045 ATGTTTTTTTATATTTAGGATGG - Intergenic
981669094 4:147265739-147265761 AAGTAATTATAAATGGAGGGGGG - Intergenic
981741357 4:148005410-148005432 ATGTTTTTTTAAATAGAGATGGG - Intronic
982659909 4:158194117-158194139 ATGTTATTAAAAATGGACGTTGG + Intergenic
983879761 4:172919563-172919585 ATATTTTTGTAAAAGAAGGAAGG + Intronic
984376856 4:178942364-178942386 ATTTTTCTATGGATGGAGGAAGG - Intergenic
984535538 4:180970122-180970144 ATATTTGTATAAATAGAGAATGG - Intergenic
984809172 4:183779029-183779051 TTGTTTGTGGAAATGGAGGATGG - Intergenic
985003471 4:185508723-185508745 ATTTATTTATAAAGGGAAGACGG + Intronic
985149572 4:186932615-186932637 ATGTGTCTAAAAATGGAGGAAGG - Intergenic
985225496 4:187756132-187756154 ATTTTTTTATAAAGGGATGTTGG + Intergenic
985363140 4:189197003-189197025 ATTTTTTCATAAATGGATGTTGG + Intergenic
985928822 5:3039396-3039418 TGGTTTTGATAAATGGAGTATGG + Intergenic
986436454 5:7736908-7736930 TTTTTTTTATAAATGGAACAAGG - Intronic
986889151 5:12279029-12279051 ATGTTTTTTCAACTAGAGGAAGG + Intergenic
986956296 5:13154737-13154759 ATTTTGCTATAAATGTAGGATGG - Intergenic
987084139 5:14453528-14453550 AAGTGTTTATAAATGTAGGATGG - Intronic
987474159 5:18370149-18370171 AAGTTTTTAAAAATAGAGGATGG + Intergenic
987729489 5:21750008-21750030 ATGTATTTATAAATGAATAACGG + Intergenic
989437460 5:41431827-41431849 TTATTTTTAGAAATGTAGGAGGG + Intronic
989701370 5:44269032-44269054 ATGTTTTTCTATATTCAGGAGGG - Intergenic
990639982 5:57771793-57771815 TAGTTTTTATAAGAGGAGGATGG + Intergenic
991046080 5:62224154-62224176 ATGTTTATAGGGATGGAGGAAGG + Intergenic
991552252 5:67851945-67851967 ATGATTTTGTAAATGGATAAAGG + Intergenic
991929176 5:71735184-71735206 TTGACTTTAAAAATGGAGGAAGG - Intergenic
992387566 5:76300334-76300356 TTGTTTTTATAATTGTAGTATGG + Intronic
993318958 5:86448178-86448200 ATGTCTTTATAAATTTAGCATGG + Intergenic
993433333 5:87859839-87859861 AAATTTTTTTAAATGAAGGAAGG - Intergenic
993462360 5:88199420-88199442 CAGTTTTTATCCATGGAGGAGGG - Intronic
994244493 5:97464384-97464406 ATTTTGTTATAATTGGGGGAGGG - Intergenic
994678222 5:102851781-102851803 ATGTTATTATTTATGGAGAAAGG + Intronic
995029972 5:107469292-107469314 ATTTTCTTATGAATGTAGGATGG - Intronic
995051018 5:107703625-107703647 ATATTTTTATAATTCGGGGATGG + Intergenic
995292727 5:110476764-110476786 ATGTTTTTATGAATGGTGGGAGG + Intronic
995458306 5:112375358-112375380 TTTTTTTTTTAAATAGAGGAAGG - Intronic
995534300 5:113119824-113119846 ATGTATTTTTAAATGAGGGACGG + Intronic
995680014 5:114705326-114705348 ATGTTTTAATAAATGGATGAAGG - Intergenic
996776211 5:127135465-127135487 GTGTGTTTATATATGGGGGAGGG - Intergenic
997169045 5:131696115-131696137 ATGATTTTATGAATGTAAGATGG - Intronic
997180244 5:131820560-131820582 CTGTTCTGAAAAATGGAGGAGGG - Intronic
998355976 5:141536996-141537018 ATTTTTTTTTAAATGGAGACAGG - Intronic
998815011 5:146004987-146005009 GTGTTTATATAAATGGATAAAGG + Intronic
999530007 5:152452537-152452559 ATTTTTTTTTAATTGGAGAAGGG + Intergenic
1000217168 5:159171377-159171399 ATGTTTCTAAATATGGAGAAAGG - Intronic
1000751305 5:165099383-165099405 ATGTTGATATAAATGCTGGAAGG - Intergenic
1001068114 5:168556369-168556391 GTATTTTTATAAATGGAGTTTGG + Exonic
1001174836 5:169458615-169458637 ATGGTTTTATTTATGGAGTAGGG + Intergenic
1001728008 5:173924086-173924108 ATGTTTCTACAGATGGAGGAAGG - Intronic
1001783619 5:174392490-174392512 ATCTTTTTCTCAAAGGAGGAGGG + Intergenic
1001831694 5:174794386-174794408 ATGTCTTTGTAAAAGTAGGAGGG + Intergenic
1002463885 5:179394165-179394187 CTGATTTTGAAAATGGAGGAAGG - Intergenic
1002684800 5:181001487-181001509 ATATTTTTATAGATGGGGGGGGG + Intronic
1003208330 6:4035665-4035687 AGGTTTTTATTAAATGAGGAAGG + Intronic
1003618872 6:7679848-7679870 ATGTTCTTAGAACTGGGGGAGGG + Intergenic
1004229770 6:13821503-13821525 ATATTTAGATATATGGAGGATGG - Intergenic
1004285852 6:14320024-14320046 ATCTTTTTACAAATGGAGCAAGG - Intergenic
1004364407 6:14999703-14999725 CTGTTCTTTGAAATGGAGGAAGG - Intergenic
1004581598 6:16959395-16959417 ATTTTTTTAGACATGAAGGATGG + Intergenic
1004618302 6:17311264-17311286 GTGTTATTATAACTGAAGGAAGG - Intergenic
1005059857 6:21765648-21765670 ATGTGTTTATGAATGTAAGAAGG - Intergenic
1005097224 6:22130619-22130641 ATGTTTTTATATTTGTAGGAGGG + Intergenic
1005925952 6:30445875-30445897 ATGGATTTACAAATGTAGGAAGG - Intergenic
1006827722 6:36948468-36948490 AAGTTTTTAGAAATAGAGAAAGG + Intronic
1007268160 6:40612664-40612686 ATTTTTTTAAAAAAGCAGGAAGG - Intergenic
1007428472 6:41762329-41762351 ATGTTTTTTTAAAAAGAGGCTGG - Intergenic
1007670036 6:43544739-43544761 ATGTTTTTATTAATAGAGATGGG - Intronic
1008315635 6:50036755-50036777 AAGTCTTTATAAAAGGAAGATGG + Intergenic
1009572424 6:65404162-65404184 CTGGTTTTAAAGATGGAGGAAGG - Intronic
1009768860 6:68119308-68119330 AGGTTTTCAAAAATGGAGGGCGG + Intergenic
1010116162 6:72315097-72315119 ATGATTTTATACAAGGAGAATGG + Intronic
1010704751 6:79094394-79094416 GTGGTTTTTTAAATGTAGGAAGG + Intergenic
1011001765 6:82597712-82597734 AGGTTTTTAAAAATGGAGTAGGG + Intergenic
1011667557 6:89649357-89649379 ATGTGTTAATAAATGGAGCTGGG + Intronic
1011931673 6:92722734-92722756 GGGTTCTTACAAATGGAGGAGGG - Intergenic
1012178933 6:96126265-96126287 AAGCTTTTATTCATGGAGGAAGG + Intronic
1012197781 6:96365987-96366009 ATATTTTTAAAAATGGACAAAGG + Intergenic
1012573616 6:100762891-100762913 ATCTTTTTTTAAATATAGGAAGG - Intronic
1013136657 6:107289074-107289096 ATATTTTAAGAAATGGAGGCCGG + Intronic
1013317322 6:108955199-108955221 AAGGTTTTAAAAATGGAGGCTGG + Intronic
1013696692 6:112710744-112710766 AAGTTTCTAGAAATGGAAGAAGG + Intergenic
1014376576 6:120682531-120682553 ATGTTTTTATAAATGGTGTAAGG - Intergenic
1014407969 6:121075061-121075083 ATGTTTTTCTAAATGTGTGATGG - Intergenic
1014682350 6:124447395-124447417 ATGTTTTCATGAAAGAAGGATGG + Intronic
1014901686 6:126973315-126973337 AGGTTTTAAGAAATGGAGAATGG + Intergenic
1014916969 6:127162442-127162464 CTGTTTTTACAAAGGAAGGAAGG - Intronic
1015379342 6:132548930-132548952 CTGGTTTTATGAATGGAGGAAGG + Intergenic
1015556346 6:134465386-134465408 ACATTTTTAAAAATTGAGGAAGG - Intergenic
1019914922 7:4126761-4126783 ATGTTTTTCTAAAAGGAGATGGG - Intronic
1020450715 7:8317623-8317645 ATGTTTTCATAAATTGAGAGAGG - Intergenic
1020999493 7:15310970-15310992 GTGTTTTTAGAAATGGAAGAGGG - Intronic
1021217007 7:17928539-17928561 AGGTTTTTTAAAAGGGAGGATGG + Intronic
1021283494 7:18749595-18749617 ATGTGTTTATAACTTGATGAAGG + Intronic
1021586152 7:22210797-22210819 ATTTTTTTTTAAATGTAGGAGGG + Intronic
1022732642 7:33044664-33044686 ATGTCTTTATCAATGGAAAAAGG + Intronic
1023658884 7:42453414-42453436 ATGTCTTTACAAAAGGAAGATGG + Intergenic
1024479436 7:49848608-49848630 ATGATTTTACAAGTGGAGAAAGG - Intronic
1026079100 7:67201291-67201313 GTTGTTTTAGAAATGGAGGAGGG - Intronic
1026226217 7:68443790-68443812 AAGCTTTTATTCATGGAGGAAGG - Intergenic
1026697723 7:72610647-72610669 GTTGTTTTAGAAATGGAGGAGGG + Intronic
1026859394 7:73775768-73775790 ATGTTTTAATAAATGGAATCAGG - Intergenic
1027440505 7:78214384-78214406 ATTGATTTTTAAATGGAGGATGG - Intronic
1028163300 7:87509964-87509986 CTGGTTTTGAAAATGGAGGAAGG + Intronic
1028179380 7:87700011-87700033 CTGTTTTTTTAAATAGAGAAAGG + Intronic
1028847156 7:95494656-95494678 AAGCTTTTATGAATGGAGAACGG - Intronic
1028972390 7:96873644-96873666 ATTTTTCAGTAAATGGAGGAAGG + Intergenic
1030195438 7:106848614-106848636 TTGTTTTAAGGAATGGAGGATGG + Intergenic
1030270586 7:107664627-107664649 ATTTTTTTAAAAAGGGATGAGGG - Intronic
1030627365 7:111858834-111858856 ATGTGTCTATACATGGAGGAAGG - Intronic
1030678990 7:112414419-112414441 ATGCTTTTAGCAATGGAGGTGGG + Intergenic
1030796994 7:113801278-113801300 ATATTTTTACAAAGGGATGATGG - Intergenic
1030842813 7:114377081-114377103 ATATTATTATTAATGGAGGAAGG + Intronic
1031076866 7:117221465-117221487 ATGATTTTTTAAATACAGGAAGG + Intronic
1031193277 7:118582486-118582508 ATGTGTTTTTACATGGAAGAGGG + Intergenic
1031476177 7:122224893-122224915 ATATTGTTATAATTTGAGGATGG + Intergenic
1032375835 7:131416670-131416692 ATATTTTTTTAAAGGGAGTAGGG - Intronic
1032790201 7:135237121-135237143 ATGGTATTATAGATGGAAGAAGG + Intronic
1033076537 7:138255079-138255101 ATGTTTTTAACAAAGGAAGAAGG - Intergenic
1033130111 7:138738662-138738684 ATGTTTTTATAAGGGCAGGGAGG + Intronic
1033154774 7:138947479-138947501 ATTTTTTTATTAATGGAGTGTGG - Intronic
1033462232 7:141557368-141557390 ATATTTTAACAAATGGAGCATGG + Intronic
1033471524 7:141653947-141653969 TTATTTTTATAAATGAATGAAGG - Exonic
1033817537 7:145092597-145092619 ACATTTTTAAAAATGGATGATGG - Intergenic
1034503935 7:151470437-151470459 TTGGTATTAGAAATGGAGGAAGG + Intronic
1034926097 7:155123382-155123404 ATGTTTTTAAAAGAGGAGAAAGG - Intergenic
1035053628 7:156019098-156019120 ATGTTTAAGTAAATGAAGGAAGG + Intergenic
1035977103 8:4324715-4324737 GTGTTGTTATATATGGATGAAGG + Intronic
1036113620 8:5933727-5933749 GTGTTTTTATAAATTTAGGGTGG + Intergenic
1036284501 8:7431938-7431960 AGATATTTATAAATGGGGGAAGG + Intergenic
1036336975 8:7879592-7879614 AGATATTTATAAATGGGGGAAGG - Intergenic
1038516370 8:28190881-28190903 TGGTTGTTATAAATGGAGAAAGG + Exonic
1039151937 8:34516179-34516201 AAGTTTTTCTGAATGAAGGAGGG - Intergenic
1039645728 8:39280279-39280301 ATTTTTTTTTAAATGGTAGAAGG + Intronic
1039858596 8:41437307-41437329 ATGTTCATATTCATGGAGGAAGG - Intergenic
1040570787 8:48607574-48607596 ATTATTTTATAAGTGGGGGAAGG + Intergenic
1040681065 8:49809838-49809860 ATGGTTTTATAAATGTTTGACGG + Intergenic
1041183835 8:55277230-55277252 ATGGATTTATAAATGATGGATGG - Intronic
1041591851 8:59596227-59596249 AAATTTTTTTAAATGGAGGGAGG + Intergenic
1042164470 8:65932286-65932308 ATGTTTTTAAAAATGGGGGGAGG + Intergenic
1042559311 8:70061080-70061102 CTGTTTTTATCAATGGAGGAGGG + Intronic
1042711908 8:71726649-71726671 ATGTTTTGAGAACTGGAGTAGGG + Intergenic
1042801688 8:72725063-72725085 ATATTTTTTTAAATGGAGAAGGG - Intronic
1042994458 8:74680149-74680171 ATGTTTTTATAAATAGACTCTGG - Intronic
1043348378 8:79327339-79327361 AAGTTTTTATAAGTGGAAGAGGG + Intergenic
1043488529 8:80723568-80723590 GTATTTTTAAAAATGGATGATGG + Intronic
1043632570 8:82354648-82354670 ATGTTTTAGGAAATGGAGGTGGG + Intergenic
1043835827 8:85044639-85044661 ATGATATTAATAATGGAGGAAGG - Intergenic
1043872447 8:85449124-85449146 TTGTTTTTATAGCTGAAGGATGG + Intergenic
1045008522 8:97936939-97936961 ATTTTTTTCTAAAAGGAGGGGGG + Intronic
1045994673 8:108349033-108349055 ATATATTAATAAATGGAGGTGGG + Intronic
1046475534 8:114737704-114737726 ATTTTTTTATATATGGTGTAAGG - Intergenic
1046785818 8:118265383-118265405 ATTTTTTTACAAGTTGAGGATGG + Intronic
1047885852 8:129249264-129249286 AAGCTTTTATTCATGGAGGAAGG - Intergenic
1048891280 8:138950372-138950394 ATATTTTTTTAAATGGGGGCTGG - Intergenic
1049920187 9:355942-355964 ATTTTTTTCTAAATGGGGGAAGG - Intronic
1050626984 9:7515219-7515241 ATGTTTTTAAAAAAAGAGAATGG + Intergenic
1050968880 9:11843474-11843496 ATGTGTTTTTAAGTGGAGGTCGG - Intergenic
1051148817 9:14058745-14058767 ATGTTTTAACAAATGCTGGAAGG - Intergenic
1051229091 9:14935264-14935286 CTGTTTTTATAACAGAAGGATGG + Intergenic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1051997141 9:23231518-23231540 ATGTTTGTATGATTAGAGGAAGG - Intergenic
1052796861 9:32931121-32931143 ATGTCCTTATAAAAAGAGGAAGG - Intergenic
1052957525 9:34265053-34265075 ATGATTTTACAAGGGGAGGAAGG + Intronic
1053116941 9:35512818-35512840 ATGTTTTTATAATTGGGGAGTGG - Intronic
1053518733 9:38754835-38754857 ATGTTTGTTTGAATGGAGGGAGG - Intergenic
1053534165 9:38909648-38909670 ATATTTTTTTAAATGGGGGTTGG - Intergenic
1053634831 9:39987063-39987085 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1053742944 9:41159719-41159741 AGGTTTTTACAGATGGAGTAGGG - Intronic
1053771095 9:41477271-41477293 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054206389 9:62134067-62134089 ATATTTTTTTAAATGGGGGTTGG - Intergenic
1054209056 9:62263634-62263656 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054315756 9:63584505-63584527 CTCATTTTAAAAATGGAGGAAGG - Intergenic
1054341933 9:63873878-63873900 ATGGTATTAGAAGTGGAGGAGGG - Intergenic
1054348221 9:63989543-63989565 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054445947 9:65315902-65315924 AGGTTTTTACAGATGGAGTAGGG - Intergenic
1054484323 9:65705608-65705630 AGGTTTTTACAGATGGAGTAGGG + Intronic
1054549829 9:66389076-66389098 CTCATTTTAAAAATGGAGGAAGG + Intergenic
1054631969 9:67454279-67454301 ATATTTTTTTAAATGGGGGTTGG + Intergenic
1054685399 9:68271581-68271603 AGGTTTTTACAGATGGAGTAGGG + Intronic
1056195125 9:84221321-84221343 ATTTTTTTATACATGCAGGTTGG + Intergenic
1056725245 9:89108694-89108716 ATGTTTTTACAACTGGTGCAGGG - Intronic
1057113668 9:92500086-92500108 ATTTATTTATACATGGAGGTAGG + Intronic
1058467885 9:105246105-105246127 TTGTTTTTAGAAATAAAGGATGG + Intronic
1059919675 9:119144677-119144699 ATATTTTTAAAAATGTAGGCTGG - Intergenic
1060322785 9:122580677-122580699 ATTCTTTTATTAATGGAGGATGG - Intergenic
1061353030 9:130081239-130081261 ATGTTTTTCTCAAAGGAGGCTGG + Intronic
1062305390 9:135903639-135903661 ATCTTTACACAAATGGAGGATGG + Intronic
1202630930 M:15660-15682 TTGTTTGGATATATGGAGGATGG - Intergenic
1185554554 X:1010184-1010206 ATGTTTTCATCAATGTGGGAAGG + Intergenic
1186903204 X:14080919-14080941 ATATTTTTATAAATGGTATAAGG - Intergenic
1187480002 X:19646765-19646787 ATGTTTTTAAAAATTCATGAAGG - Intronic
1188330765 X:28868498-28868520 ATGGTTATAGAAATGGAGAAGGG - Intronic
1188786493 X:34352916-34352938 ATTTTTTTTTTATTGGAGGAAGG + Intergenic
1189000845 X:36943339-36943361 ATGTTTTTATAAATTGAACATGG + Intergenic
1189601147 X:42627819-42627841 ATCTTTTTAAAAATGCATGAAGG - Intergenic
1189615290 X:42777163-42777185 ATGGTTTTATAAAAGGAATATGG + Intergenic
1190432019 X:50387370-50387392 ATCTTTTGCTAAATGAAGGATGG - Intronic
1191820680 X:65303487-65303509 ATTTTATTAAAAATGGATGATGG - Intergenic
1192631170 X:72778965-72778987 ATCTTTTTATATTTGGGGGAGGG - Intronic
1192650539 X:72941836-72941858 ATCTTTTTATATTTGGGGGAGGG + Intronic
1192806709 X:74516449-74516471 ATTTTATTATAAATGAGGGAGGG + Intronic
1193021014 X:76793390-76793412 TTTTTTTTTTAAAGGGAGGATGG - Intergenic
1193572317 X:83159871-83159893 ATTTTTTTATAAATGGCCAAGGG - Intergenic
1194111367 X:89838549-89838571 ATGTTTATGTAATGGGAGGATGG - Intergenic
1195379543 X:104257276-104257298 TTTTTTTTCTTAATGGAGGAAGG - Intergenic
1197442217 X:126506477-126506499 ATTTTGTTGAAAATGGAGGATGG + Intergenic
1198282196 X:135153415-135153437 ATGTGATCATATATGGAGGAGGG - Intergenic
1198288763 X:135219107-135219129 ATGTGATCATATATGGAGGAGGG + Intergenic
1198325119 X:135563264-135563286 ATTTTATTATAAATAGAGGAGGG - Intronic
1198329342 X:135607412-135607434 ATATTTTCATGAATGGTGGAAGG + Intergenic
1198720931 X:139619326-139619348 ATGTTGTTATGATGGGAGGAAGG + Intronic
1198826963 X:140708982-140709004 ATGAACTTATAAAGGGAGGATGG + Intergenic
1199327737 X:146520400-146520422 ATTTTATTATAAATGGTGGAAGG + Intergenic
1199693046 X:150323607-150323629 ATTATATTATAAATGGGGGAGGG + Intergenic
1199892367 X:152098914-152098936 ATGTATTTATATATGCATGATGG + Intergenic
1200464033 Y:3493345-3493367 ATGTTTATGTAATGGGAGGATGG - Intergenic
1200798102 Y:7360368-7360390 TTGTTTTTTTAAATAGAGGTGGG + Intergenic
1201013159 Y:9570507-9570529 ATGTATTTAGGAATGGAAGAAGG - Intergenic
1201303149 Y:12527565-12527587 ATTTTATTATGAATGCAGGAAGG + Intergenic
1201501699 Y:14650596-14650618 ATATTTTTATATATGGAGTTAGG + Intronic
1201720217 Y:17088999-17089021 GAGTTTTTATTTATGGAGGAAGG + Intergenic
1201906454 Y:19090733-19090755 ATGTTCTTTTTAAAGGAGGAAGG + Intergenic