ID: 1159101762

View in Genome Browser
Species Human (GRCh38)
Location 18:63966117-63966139
Sequence CTGTGCCAGTGTTCCACTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159101762_1159101768 9 Left 1159101762 18:63966117-63966139 CCCTAAGTGGAACACTGGCACAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1159101768 18:63966149-63966171 AATCGCAGTGTGGGTTTTCGTGG 0: 1
1: 0
2: 0
3: 4
4: 51
1159101762_1159101766 -1 Left 1159101762 18:63966117-63966139 CCCTAAGTGGAACACTGGCACAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1159101766 18:63966139-63966161 GCAGGGACTGAATCGCAGTGTGG 0: 1
1: 0
2: 0
3: 17
4: 119
1159101762_1159101767 0 Left 1159101762 18:63966117-63966139 CCCTAAGTGGAACACTGGCACAG 0: 1
1: 0
2: 0
3: 5
4: 103
Right 1159101767 18:63966140-63966162 CAGGGACTGAATCGCAGTGTGGG 0: 1
1: 0
2: 1
3: 4
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159101762 Original CRISPR CTGTGCCAGTGTTCCACTTA GGG (reversed) Intronic
903574107 1:24327385-24327407 ATGTGCCAGTGTGCCAGTCAGGG - Intronic
910131306 1:83910314-83910336 CTGTCCTAGGGTTCCACTAAAGG - Intronic
913256721 1:116960759-116960781 CTGAGCCACTGTGCCACTGATGG + Intronic
914883422 1:151565418-151565440 CTGGGCCACTGTTCCCCTCAAGG - Intronic
915431803 1:155872502-155872524 CTGTTCCTCTGTTCCACTGAAGG + Intronic
915809923 1:158897382-158897404 TTGTCCCAGTGTTTCAGTTAAGG - Intergenic
920245747 1:204586027-204586049 CTCTGCAAGGGTTCCACATATGG - Intergenic
920951047 1:210572064-210572086 CCGTGCCAGTGTAACATTTACGG - Intronic
923072914 1:230582014-230582036 CTGTGCCAGGGGTGCATTTATGG - Intergenic
1069077164 10:64050770-64050792 CTCTGCCACTGTTCCACAAAGGG + Intergenic
1071409402 10:85374013-85374035 CTGTGCCATTTTGCCTCTTAGGG - Intergenic
1072031500 10:91526401-91526423 CTCTGCCAGGCTTCCACTGAGGG - Intergenic
1075704085 10:124488622-124488644 CTGTGCCAGTCTCCAACTTGCGG + Intronic
1077122291 11:915211-915233 CTCTGCCTGTGTTCCACGTGTGG + Intergenic
1078985367 11:16589101-16589123 CTGTCCCAGGTTTCCAGTTATGG + Intronic
1079325714 11:19489813-19489835 CCGTGACAGTGTTCCTCTCATGG - Intronic
1081516001 11:43830708-43830730 CTGTGCCAGTATTACATTTCAGG + Intronic
1085768663 11:79306285-79306307 GAGTGACAGTGTTCCACTCAGGG + Intronic
1086633665 11:89055207-89055229 CTGTGCCAGGATTCCAATTCAGG - Intronic
1092315333 12:7406733-7406755 CTGCAGCATTGTTCCACTTATGG + Exonic
1097933011 12:65211758-65211780 CTGTAGCAGTGTTATACTTAAGG - Intronic
1099589774 12:84572302-84572324 ATCTGATAGTGTTCCACTTAAGG + Intergenic
1099944628 12:89230401-89230423 CTGTGCCACTTTTCCAGTTTAGG - Intergenic
1104419001 12:128619675-128619697 CTGTGCCAGTGTTAGGCTTGGGG + Intronic
1105444719 13:20443181-20443203 CTGTGCCAGTTTTCCACATCAGG - Intronic
1113648027 13:112012598-112012620 CTCTGACAGTGTCCCACTTTGGG - Intergenic
1114501020 14:23168735-23168757 GAGTGTCAGTGTTCCACTAAGGG + Intronic
1120737912 14:88076124-88076146 CTGTGCCAGTGTATCAGTTTGGG + Intergenic
1124211674 15:27769824-27769846 CTGTGCCAGTGGACCCCTTGAGG + Intronic
1124825646 15:33092468-33092490 ATGTGACAGTGTGCCAATTAAGG + Intronic
1127635944 15:60869789-60869811 CAGGGCCAGGGTTCCCCTTAGGG - Intronic
1127779089 15:62295770-62295792 CTCTGGCAGTGTTACCCTTAGGG + Intergenic
1130653023 15:85772992-85773014 CTGAGCCAATCTTCCACTGATGG + Intronic
1133275800 16:4637814-4637836 GTGTGCCAGTGTCCACCTTAGGG + Intronic
1148094155 17:45040937-45040959 CTCTGGCAGTGTTTCTCTTAGGG + Intronic
1148215608 17:45832659-45832681 CTGTGCAAGTATTCCTCTCAAGG + Intronic
1150045858 17:61912699-61912721 CTTTGCATTTGTTCCACTTAGGG - Intronic
1150524870 17:65912099-65912121 CTGAAACAGTTTTCCACTTAGGG - Intronic
1150844960 17:68647127-68647149 CTGTGGCAGTGCACCTCTTATGG + Intergenic
1151495971 17:74458279-74458301 CTCTGCCAGGGCTCCACTCATGG + Intergenic
1159101762 18:63966117-63966139 CTGTGCCAGTGTTCCACTTAGGG - Intronic
1166699828 19:44875844-44875866 CTGTGACAGTGTTTCCCGTAGGG - Intronic
927432579 2:23039646-23039668 GTGTGCCTGTGTTTAACTTAGGG - Intergenic
928411205 2:31055567-31055589 CTGTGCCACTGATCCAACTAGGG + Intronic
931569039 2:63648819-63648841 AATTGGCAGTGTTCCACTTAAGG - Intronic
932797724 2:74712070-74712092 TTATGCCAGTGTGGCACTTAAGG - Intergenic
934933246 2:98445233-98445255 CGGTGCCAGTGGTCCACCTGCGG + Intronic
942061337 2:172231173-172231195 CCTCCCCAGTGTTCCACTTAAGG + Intergenic
946280383 2:218661931-218661953 CTCTGTCAGTGTACCACTTGGGG - Exonic
947450225 2:230201129-230201151 CTGTGCCTGTCTGCCACTCAGGG + Intronic
947841898 2:233213065-233213087 CTGTGGCAGTTGTCCACTTCTGG - Intronic
1171363018 20:24603508-24603530 CTGAGGCAGTGTCCCACTCAGGG - Intronic
1178917820 21:36718821-36718843 CTGTGCCACTGTCCATCTTAAGG + Intronic
1182705218 22:32272739-32272761 CTGTGCCAGGGAGCCACTGAGGG + Intergenic
1183347419 22:37315478-37315500 CTGTGCCAGTGTTCCGGGGATGG - Intergenic
951876620 3:27433525-27433547 CTGTTCCAGTCTTACACTAAGGG - Intronic
953259818 3:41326921-41326943 CTGTGGCAATGTTTCACGTAAGG + Intronic
954864285 3:53715784-53715806 CTGTGCCAGGGCTCCACTGAGGG - Intronic
963458824 3:145579600-145579622 CTCTGCCATTATTCCTCTTAAGG + Intergenic
963496925 3:146076209-146076231 CTGTGCCATTAATTCACTTAGGG + Intronic
965012299 3:163109145-163109167 TCGTGCCATTGTTTCACTTAAGG - Intergenic
965230926 3:166052057-166052079 CTGTGCTACTGTTGCACTTTGGG - Intergenic
966436693 3:179892979-179893001 CTGTGTCAGTTGACCACTTAAGG - Intronic
966455538 3:180111303-180111325 CTGTCCCAGTTTTTCTCTTAGGG + Intergenic
967639521 3:191844677-191844699 GTTTTCCAGTTTTCCACTTAGGG - Intergenic
969495093 4:7521961-7521983 CTGTGTCACTGTGCCACTGAAGG - Intronic
977115162 4:93015227-93015249 CTATGCCAGAGTTCCATTTTTGG - Intronic
977441456 4:97073173-97073195 TTGTTCCAGTGTTCCTCTTTTGG + Intergenic
978662237 4:111140753-111140775 CTGTGCAAGTGTTTCAGGTAAGG + Intergenic
979339225 4:119500903-119500925 ATGTGCCAGTGTTACCCTCAAGG - Intronic
979428859 4:120602454-120602476 CTGTGACACTGTTCCAGTTCGGG + Intergenic
981607126 4:146551478-146551500 CTGAGACAGATTTCCACTTAAGG - Intergenic
987922681 5:24304071-24304093 ATATGCCAGTGTTGCACTTGTGG - Intergenic
991217253 5:64169987-64170009 GTGAGCCAGTATTCCACTTCTGG + Intronic
995217645 5:109613754-109613776 CTTTGCCAGTGTTTCACTCATGG + Intergenic
997807147 5:136929482-136929504 CAGTTTCAGTGTTCCACATATGG + Intergenic
1003643264 6:7893499-7893521 GTGTGGCAGTGACCCACTTAGGG + Intronic
1007339109 6:41179077-41179099 CTTTGCCAGTTTTCCACTCCAGG + Intergenic
1008943265 6:57070354-57070376 CTGTGGCAGTGTTCCTCACAAGG - Intergenic
1012525996 6:100178299-100178321 ATGTGCAAGTGTTCTAATTAAGG - Intergenic
1021406327 7:20271179-20271201 ATGTGCCAGTTATCCATTTATGG - Intergenic
1022035486 7:26530091-26530113 CTGTGGCAGAATTCCTCTTAGGG - Intergenic
1022966009 7:35472852-35472874 CTCTGCCCATGGTCCACTTACGG + Intergenic
1022967604 7:35487937-35487959 CTGTTCCAGTGTTGCAACTATGG + Intergenic
1024024948 7:45402049-45402071 CTGTGCCCCTTTTCCAGTTATGG + Intergenic
1025768434 7:64481140-64481162 TTGAGCAAGTGTTCCACTTCTGG + Intergenic
1030048923 7:105521650-105521672 CAGGGCCAGTGTTCCTCTGACGG + Intronic
1032876709 7:136045837-136045859 CTGTTACACTTTTCCACTTATGG - Intergenic
1033112263 7:138590669-138590691 GTTTGCCAGTGTTTCACTTGAGG - Intergenic
1033775605 7:144606934-144606956 CTGTGCCAGTGTACCTCAAAGGG - Intronic
1034542348 7:151766558-151766580 CTGAGCCAGTGTTCCAAATCAGG - Intronic
1035011114 7:155715663-155715685 CTGTGTCAGTGTACCTCTGAAGG - Intronic
1039270817 8:35878104-35878126 ATCTGCCACTGGTCCACTTAAGG + Intergenic
1039987586 8:42460806-42460828 GTGTGCCAGTGTTACATTGATGG - Intronic
1041617650 8:59926991-59927013 CTGAGACAGTGTTTCACTTAAGG + Intergenic
1042496731 8:69463380-69463402 CTGTGCCACTGTGCCACTGGGGG - Intergenic
1046475853 8:114742016-114742038 CTGTGCCAGTGCTCAATTTAAGG + Intergenic
1047046454 8:121058202-121058224 CTATCCCAGTTTTCCATTTATGG - Intergenic
1049005018 8:139849338-139849360 CTGTCCCTGTGTTCTACTCAGGG + Intronic
1049724151 8:144137785-144137807 CGGTGCCAGCGGTCCGCTTAGGG - Exonic
1049995212 9:1027734-1027756 ATATGCCAGTGTCCCACTGAAGG + Intergenic
1057715207 9:97488291-97488313 CTGTCACTGTGTTCCACATATGG - Intronic
1185789882 X:2920673-2920695 CTGAGCCTGCGTTCCACTGAAGG + Exonic
1187002824 X:15199968-15199990 CTGGGCCTGTGATTCACTTATGG + Intergenic
1190600215 X:52084418-52084440 CAGTGTCAGTTTTCCACATATGG + Intergenic
1192864799 X:75119414-75119436 TTATTCCAGTGTTCAACTTACGG - Intronic
1193672636 X:84408239-84408261 CAGTTTCAGTGTTCCACATATGG + Intronic
1200148748 X:153941331-153941353 CTGTGCCAGTGTTACAGGAAAGG - Intronic
1201622498 Y:15975793-15975815 TTGTGCCTGTGATCCACTAATGG - Intergenic