ID: 1159102902

View in Genome Browser
Species Human (GRCh38)
Location 18:63974863-63974885
Sequence GCACATGTATTGTGGCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159102899_1159102902 7 Left 1159102899 18:63974833-63974855 CCAAGGGGGTGCACTTGTGTGTG 0: 1
1: 0
2: 2
3: 12
4: 176
Right 1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 118
1159102898_1159102902 19 Left 1159102898 18:63974821-63974843 CCTGAGCAGAGGCCAAGGGGGTG 0: 1
1: 1
2: 2
3: 38
4: 324
Right 1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159102902 Original CRISPR GCACATGTATTGTGGCTGCA GGG Intronic
902212826 1:14915912-14915934 GCCCACGTAGTCTGGCTGCAAGG - Intronic
902924424 1:19686683-19686705 ACACATATTTAGTGGCTGCAGGG + Intronic
907868434 1:58421193-58421215 CCACATGGATGGTGGCAGCAAGG + Intronic
910133068 1:83932511-83932533 TAACATGTATTGTGTCTCCAAGG - Intronic
920846482 1:209597232-209597254 GAACATGTATGATGGCTTCAAGG + Intronic
923246805 1:232140101-232140123 ACAAATGTATTCTGGCTGCTGGG - Intergenic
1065160546 10:22916561-22916583 TAACATGTAGTGTGGTTGCAAGG - Intergenic
1069659435 10:70113911-70113933 GCTCATGTGTGCTGGCTGCATGG - Exonic
1073083000 10:100871653-100871675 GAACACGTATTGGGGGTGCAGGG - Intergenic
1075103810 10:119524105-119524127 GCACATGTGTCGTGGGAGCAAGG - Intronic
1078704503 11:13727657-13727679 TCAGATGTTTTCTGGCTGCAGGG - Exonic
1080269007 11:30430895-30430917 GCACATGTATGATGGGTGAATGG - Intronic
1082104537 11:48207105-48207127 GCATGAGTATTATGGCTGCACGG - Intergenic
1082733650 11:56831151-56831173 TCATATGTATGTTGGCTGCATGG - Intergenic
1087902673 11:103659898-103659920 ACACATGTATTGTTGTTGTATGG + Intergenic
1091450210 12:568094-568116 GTACATATATTGAGGATGCATGG - Intronic
1093904935 12:24679282-24679304 GCAAATGTTCTGTTGCTGCACGG - Intergenic
1100321142 12:93494062-93494084 GTTCATGTATTCTGGCTACATGG - Intronic
1100321532 12:93497936-93497958 GTTCATGTATTCTGGCTACATGG + Intronic
1102499500 12:113341713-113341735 GCAGAAGTAGTGTGGCTTCATGG + Intronic
1103271026 12:119673956-119673978 ACAAAGTTATTGTGGCTGCAAGG - Exonic
1104898765 12:132176646-132176668 GCGCATGGAATGGGGCTGCAGGG + Intergenic
1108339287 13:49481372-49481394 GCACATTTGTTTTGTCTGCATGG + Intronic
1108937933 13:55909241-55909263 GAACATGAAATGTGACTGCAAGG + Intergenic
1109575748 13:64255305-64255327 ATACCTGTAATGTGGCTGCAGGG - Intergenic
1110232213 13:73178853-73178875 CCACATGTGTGGTGTCTGCAGGG - Intergenic
1115211562 14:30971818-30971840 GTACACCTATTATGGCTGCAAGG - Intronic
1117875029 14:60243433-60243455 TTACATGCATTGTGTCTGCATGG - Intergenic
1118463610 14:66010755-66010777 GCACATGTACAGTGTCAGCAGGG + Intergenic
1118876098 14:69786109-69786131 GCGCATGTATTGTGGCCGTTTGG + Exonic
1118972443 14:70648469-70648491 TCCCATGTATTTTGGCTGTAGGG - Intronic
1125182753 15:36896095-36896117 TCACATGTATTTTAGCAGCATGG + Intronic
1125388744 15:39168818-39168840 GCACCTGTATTTTATCTGCATGG + Intergenic
1129941441 15:79500521-79500543 GCACATGCTTGGTGGCAGCATGG + Intergenic
1135665052 16:24328752-24328774 GTACATGTCTTATGGCTGCCAGG - Intronic
1135871774 16:26157789-26157811 GCATATGTATTAGGGCTGGAAGG - Intergenic
1143941272 17:10544542-10544564 ACATATATATTGTGGGTGCAAGG + Intronic
1143962399 17:10731490-10731512 GCATATGAATTGGGGGTGCAGGG - Intergenic
1144457844 17:15433470-15433492 CCACATGGAGTGAGGCTGCAGGG + Intergenic
1145318093 17:21746873-21746895 TCATGTGTCTTGTGGCTGCAGGG - Intergenic
1151937305 17:77270478-77270500 GCAAAGGTCCTGTGGCTGCAAGG - Intergenic
1152643621 17:81459150-81459172 TCACATGTCGGGTGGCTGCAGGG - Exonic
1155303533 18:24456066-24456088 GCAAATGTTTTGTTGCTTCATGG - Intergenic
1156630331 18:38960711-38960733 GCAGAGGTAGTGTGGCTGAAAGG + Intergenic
1157788420 18:50507540-50507562 GCACATGTATTGTTGCTGAAGGG - Intergenic
1159102902 18:63974863-63974885 GCACATGTATTGTGGCTGCAGGG + Intronic
1160423303 18:78763881-78763903 GCACATGTTTTGGGGAAGCAAGG + Intergenic
1161546688 19:4885231-4885253 GCAAATGTGTCATGGCTGCAGGG + Intergenic
1161546782 19:4885796-4885818 GCAAATGTGTCATGGCTGCAGGG + Intergenic
1161547102 19:4888018-4888040 GCAAATGTGTCATGGCTGCAGGG + Intergenic
1162838174 19:13335389-13335411 GCACTTGTATGGTGGCTCTATGG - Intronic
1163769265 19:19180757-19180779 GCACATGTTTTGTTGCAGCCCGG - Exonic
1166268201 19:41697635-41697657 CCACATGTATTGTACCTGCAGGG - Intronic
1166352785 19:42208028-42208050 GCACGGGTATTGTGAGTGCAGGG - Intronic
1166935611 19:46330653-46330675 GCAGATGTATGGTGGATGGATGG + Intronic
926946756 2:18196425-18196447 GAACAGTTATTGTGACTGCATGG - Intronic
928305112 2:30163127-30163149 GCAGATGTTTTGTAGCAGCAAGG - Intergenic
928395629 2:30941392-30941414 TGACATGTATTATGCCTGCATGG + Intronic
928734984 2:34278036-34278058 GCACATGAAATGTGTCTACATGG + Intergenic
934528228 2:95066295-95066317 ACACATGTATTTTCTCTGCAAGG + Intergenic
935123851 2:100205505-100205527 GCACATGTGAAGTGGCTGCGGGG + Intergenic
939172167 2:138709058-138709080 ACACATGTATTCTAGCAGCAGGG + Intronic
941315339 2:163985145-163985167 GCACATGTATTGTGATCCCATGG + Intergenic
942878691 2:180833319-180833341 GCACATGTATGCAGGCTGAATGG - Intergenic
943239686 2:185366584-185366606 GCACATTTATTGTGACTTTATGG - Intergenic
946728689 2:222687782-222687804 GCACATGAATAATGGCTGCTTGG + Intronic
1168788382 20:559065-559087 GCACATGCACTGTGACTGCATGG + Intergenic
1169469009 20:5867220-5867242 GAATTTGCATTGTGGCTGCAGGG - Intergenic
1169717441 20:8636160-8636182 GCACATGTATTCTACCTGCAAGG - Intronic
1170461296 20:16579121-16579143 TCACATGTCTGGTGGCTGCCTGG - Intergenic
1173402269 20:42736203-42736225 GCCCATGTATTTTCCCTGCAGGG - Intronic
1173461686 20:43248120-43248142 GTACTTGGATGGTGGCTGCATGG + Intergenic
1175423644 20:58851231-58851253 CCACATGGATGGTGGATGCAGGG + Intronic
1177618180 21:23553153-23553175 GCATATGTATTGGTTCTGCATGG + Intergenic
1177946159 21:27472094-27472116 CCAAATATATTGTAGCTGCATGG + Intergenic
1178426042 21:32479091-32479113 TCACATGTATTGGGGGTGGAGGG + Intronic
1183715602 22:39531718-39531740 GTACAGGCATTGTGGCTGCCCGG - Intronic
1184356048 22:43980203-43980225 ACACATGTATGCTGGCTGCCAGG + Intronic
1184944577 22:47794059-47794081 GCACCTGTGTTGTGCCTGCCTGG + Intergenic
949179204 3:1106817-1106839 TCACATGTATTTTTACTGCATGG + Intronic
957206145 3:77200933-77200955 GCACAAGTCTTTTGGCTGAAAGG + Intronic
959788054 3:110325309-110325331 TCACATGTATTATGGATGCAAGG + Intergenic
962138090 3:132758830-132758852 GGACATAGATTGTGGCTGCTAGG + Intergenic
962183960 3:133238693-133238715 GCTCATGTATTTTGTCTTCATGG + Intronic
963317296 3:143773332-143773354 GTACATGTATTGTAGCTATATGG - Intronic
963860401 3:150303945-150303967 GCATAGGTCTTGTGACTGCATGG + Intergenic
964513233 3:157476674-157476696 GCTCATGTATTCTACCTGCAGGG - Intronic
967466148 3:189808264-189808286 GTTCGTGTACTGTGGCTGCAAGG - Exonic
971654546 4:29326270-29326292 TCACATGTATTGTAATTGCAGGG + Intergenic
972897456 4:43641007-43641029 ACTCAGGGATTGTGGCTGCATGG + Intergenic
973343104 4:49026330-49026352 GGAAGTGTATTGTTGCTGCAGGG - Intronic
976284618 4:83359508-83359530 GCACATATATTGTTAGTGCAAGG - Intergenic
977423135 4:96828908-96828930 GCAAATATACTGTGGCTGCATGG + Intergenic
978974174 4:114848483-114848505 ACACTTAGATTGTGGCTGCATGG - Intronic
982635900 4:157896347-157896369 GCACATGTGTGTTGGCTGAAAGG + Intergenic
985949676 5:3213884-3213906 GCACAAGCATCGTGGCTGCAGGG - Intergenic
986547014 5:8908506-8908528 GCACAAGCTTTGTGGCTCCAAGG - Intergenic
990684657 5:58287999-58288021 GCAAATGCATTTTAGCTGCAAGG - Intergenic
994679820 5:102872530-102872552 ATACATGTATTGTGGAGGCAAGG - Intronic
1007411065 6:41661899-41661921 TCACAGGTAGTGTGGCTCCAGGG - Intergenic
1012335803 6:98055597-98055619 ACACATGTATTGAGGCTCAAGGG - Intergenic
1012621584 6:101351157-101351179 ACACATGTATTGAAGTTGCATGG + Intergenic
1013252445 6:108347957-108347979 GCAAATGTGTTGTGGCTATAGGG - Intronic
1013724449 6:113076574-113076596 GCACATGATGTGGGGCTGCATGG + Intergenic
1017521559 6:155207428-155207450 GCACATTGCTGGTGGCTGCAGGG + Intronic
1019890784 7:3944322-3944344 CAAGATGTTTTGTGGCTGCATGG + Intronic
1023488214 7:40709655-40709677 GCACTTGTACTCTGGCTGCTTGG - Intronic
1024849603 7:53695925-53695947 ACACATGGTTTTTGGCTGCATGG + Intergenic
1031811447 7:126374572-126374594 GCACATGTATTCCCACTGCAAGG - Intergenic
1034377138 7:150656046-150656068 TCACAGGTATAGTGGCTGGAGGG + Intergenic
1034739308 7:153458676-153458698 TCACAAGTATTGTGGCTAAATGG + Intergenic
1036020735 8:4842580-4842602 GCACATGTATCCCTGCTGCAGGG + Intronic
1036498629 8:9293727-9293749 GCACAGGTATTGCTGTTGCAAGG - Intergenic
1038827571 8:31021583-31021605 GCAGATGTATAGTGGCGGCTGGG + Intronic
1042354884 8:67816409-67816431 ACACATGTAGTCTGGATGCAGGG + Intergenic
1049386314 8:142344744-142344766 GCACCTCTGTGGTGGCTGCAGGG - Intronic
1049740921 8:144240476-144240498 CCCCATGTGCTGTGGCTGCAGGG - Intronic
1050120856 9:2305620-2305642 GCACATGGACTATGGCTGAATGG + Intergenic
1054702485 9:68427224-68427246 GCCCATGTAATGTGATTGCAGGG + Intronic
1059235307 9:112755708-112755730 GCCCAGGTATTTTGGCTTCAGGG + Intronic
1060545710 9:124457922-124457944 GCACATGGACTGTGGCTGCTTGG + Intronic
1187057004 X:15750120-15750142 GTACAAGTATAGAGGCTGCAGGG - Exonic
1191029835 X:55957591-55957613 GCACATGTCTTGTGCCTCCTTGG + Intergenic
1194076698 X:89403196-89403218 GAACATGTATTGTTGCTAAATGG + Intergenic
1194979597 X:100426872-100426894 GAACATGAATTGGGGGTGCAGGG + Intergenic
1195562746 X:106302458-106302480 GCACTGGGTTTGTGGCTGCATGG - Intergenic
1199818647 X:151423003-151423025 ACACATGTATTGGGGCTTCAGGG + Intergenic
1200429341 Y:3058724-3058746 GAACATGTATTGTTGCTAAATGG + Intergenic