ID: 1159103524

View in Genome Browser
Species Human (GRCh38)
Location 18:63980779-63980801
Sequence AAGAGGATATAGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 991
Summary {0: 1, 1: 0, 2: 4, 3: 90, 4: 896}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159103524_1159103533 23 Left 1159103524 18:63980779-63980801 CCTCCTTCCCTCTATATCCTCTT 0: 1
1: 0
2: 4
3: 90
4: 896
Right 1159103533 18:63980825-63980847 TGAGAACAGGGAATGGACAGAGG 0: 1
1: 1
2: 1
3: 36
4: 383
1159103524_1159103530 10 Left 1159103524 18:63980779-63980801 CCTCCTTCCCTCTATATCCTCTT 0: 1
1: 0
2: 4
3: 90
4: 896
Right 1159103530 18:63980812-63980834 AAATTAAAATATTTGAGAACAGG 0: 1
1: 1
2: 7
3: 106
4: 1007
1159103524_1159103531 11 Left 1159103524 18:63980779-63980801 CCTCCTTCCCTCTATATCCTCTT 0: 1
1: 0
2: 4
3: 90
4: 896
Right 1159103531 18:63980813-63980835 AATTAAAATATTTGAGAACAGGG 0: 1
1: 0
2: 9
3: 107
4: 917
1159103524_1159103534 27 Left 1159103524 18:63980779-63980801 CCTCCTTCCCTCTATATCCTCTT 0: 1
1: 0
2: 4
3: 90
4: 896
Right 1159103534 18:63980829-63980851 AACAGGGAATGGACAGAGGCTGG 0: 1
1: 0
2: 2
3: 58
4: 472
1159103524_1159103535 28 Left 1159103524 18:63980779-63980801 CCTCCTTCCCTCTATATCCTCTT 0: 1
1: 0
2: 4
3: 90
4: 896
Right 1159103535 18:63980830-63980852 ACAGGGAATGGACAGAGGCTGGG 0: 1
1: 0
2: 3
3: 43
4: 400
1159103524_1159103532 16 Left 1159103524 18:63980779-63980801 CCTCCTTCCCTCTATATCCTCTT 0: 1
1: 0
2: 4
3: 90
4: 896
Right 1159103532 18:63980818-63980840 AAATATTTGAGAACAGGGAATGG 0: 1
1: 0
2: 5
3: 37
4: 540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159103524 Original CRISPR AAGAGGATATAGAGGGAAGG AGG (reversed) Intronic
900815698 1:4842283-4842305 AAGAGGATCAAGAGACAAGGAGG + Intergenic
901126745 1:6934681-6934703 AAGAGGGGAGAGAGGGGAGGGGG - Intronic
901640588 1:10691088-10691110 AAAAGGAAAGAGAGGGAGGGAGG - Intronic
901938584 1:12644992-12645014 AGGAGGAAGGAGAGGGAAGGAGG - Intronic
902059588 1:13630932-13630954 AAGTGTATACAGAGGGCAGGTGG - Intergenic
902364112 1:15959596-15959618 GAGAGTAGACAGAGGGAAGGAGG + Intronic
902628327 1:17689539-17689561 AAGAAGAGAGGGAGGGAAGGAGG - Intronic
902778916 1:18692175-18692197 AGGGAGAGATAGAGGGAAGGGGG + Intronic
903139852 1:21332802-21332824 GCGAGGAGTTAGAGGGAAGGGGG + Intronic
904369298 1:30038375-30038397 AAGAGGAGATGGAGGCACGGAGG - Intergenic
904390824 1:30184659-30184681 AAGAGGAAAGAGAGGAAAGATGG - Intergenic
904492011 1:30866860-30866882 AACAGAATCAAGAGGGAAGGAGG - Intergenic
904522823 1:31109168-31109190 AGGAAGAAATAGAAGGAAGGAGG - Intergenic
904526302 1:31136382-31136404 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
904890153 1:33773667-33773689 AGGAGGAAGAAGAGGGAAGGAGG + Intronic
904893683 1:33798448-33798470 AAGAGGAGAGAGATGGAAGGGGG + Intronic
904933422 1:34108690-34108712 AAGAGGCTGAAGAGGGAAAGGGG + Intronic
905088430 1:35406103-35406125 AAGAAGATATAGTTGGAAAGTGG - Intronic
905094404 1:35456841-35456863 AAGGAGAGATGGAGGGAAGGAGG + Intronic
905229275 1:36504000-36504022 AAGAGGATAGAGAGAGAAAGAGG - Intergenic
905495750 1:38384515-38384537 CAGAGGAGAAAGATGGAAGGTGG - Intergenic
905509522 1:38507712-38507734 AAGAGGATAAACAGGGAGTGGGG + Intergenic
905949827 1:41940813-41940835 GAGAGGATAAAGAGAGAAGCTGG + Intronic
905950104 1:41943301-41943323 AAGAGGATTTAGGTGGAAGCTGG + Intronic
906232250 1:44173753-44173775 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
907678829 1:56544451-56544473 AAGAGGATTCAAAAGGAAGGAGG - Intronic
908741020 1:67327704-67327726 AGGAGGAGATGGAGGAAAGGAGG + Intronic
908913919 1:69104211-69104233 TAGAGTATAGAGAGTGAAGGGGG - Intergenic
909111235 1:71480393-71480415 AAAAGGAGAAAGAGGAAAGGAGG - Intronic
909469390 1:76009919-76009941 AAGAGGATAAAGAGGATGGGTGG + Intergenic
909606236 1:77511401-77511423 AACAGGATAAAGAAGGATGGAGG + Intronic
909680601 1:78287325-78287347 AAGAGGAGCAAGAGAGAAGGAGG - Intergenic
909845663 1:80390725-80390747 AAGGGGAGATAGAGAGAAGTTGG + Intergenic
910149627 1:84126355-84126377 AAGCGGATGGAGTGGGAAGGTGG + Intronic
910450511 1:87338876-87338898 AGGAGCAGATAGAGGGAAGTTGG + Intronic
910480360 1:87652161-87652183 AACAAGATATAAAGGGCAGGTGG + Intergenic
911378651 1:97084473-97084495 AAGAGGATATGGAGGAGAGAGGG - Intronic
911631834 1:100192159-100192181 AAGACAGTGTAGAGGGAAGGGGG + Exonic
911764453 1:101657017-101657039 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
912323053 1:108732715-108732737 AAGAGAAAAGAGAGGGAGGGAGG - Intronic
912497272 1:110099733-110099755 AAGAGGATGAAGAGGGGAGGGGG + Intergenic
912826844 1:112912541-112912563 ATAAGGATAAGGAGGGAAGGTGG - Exonic
912897472 1:113608219-113608241 AAGAGGGAAGAGAGGGAGGGAGG + Intronic
913168761 1:116213020-116213042 GAGAGGACACAGAGAGAAGGTGG + Intergenic
913380105 1:118201351-118201373 AAGAGGAGATAGAGAAAGGGAGG - Intergenic
914447618 1:147763251-147763273 ATGAGGATACAGCAGGAAGGAGG + Intronic
914461696 1:147891117-147891139 AAGAGGAGGTAAAAGGAAGGGGG + Intergenic
914678487 1:149922206-149922228 GAGTGGATATTGAGGGAAGCTGG - Intergenic
914733629 1:150395149-150395171 AGGAGGAAAGAGTGGGAAGGGGG - Intronic
914788489 1:150854881-150854903 AAGGGGAAAGAGAGGGAAGGAGG + Intronic
914880632 1:151543942-151543964 AAGAAGGAAGAGAGGGAAGGAGG - Intronic
914935768 1:151978630-151978652 AAAAGGAAAGAAAGGGAAGGAGG + Intergenic
914984889 1:152448003-152448025 CAGAGGAGACAGAGAGAAGGTGG + Intergenic
915022052 1:152788202-152788224 AAGAGGTGATAGTGGGAAGGAGG - Exonic
915044499 1:153000586-153000608 AAGAGGAAAGATAGGGAGGGAGG - Intergenic
915616393 1:157042854-157042876 AAGAGGATGAAAAGGGAAGAAGG + Intronic
915969480 1:160343585-160343607 AAGAGGATTTACAGGGTGGGGGG - Intronic
916929632 1:169562002-169562024 AGGAAGAAAGAGAGGGAAGGAGG - Intronic
917209419 1:172616374-172616396 AAGAGGAAATAAAGGGAAAGAGG - Intergenic
917539419 1:175898631-175898653 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
917554253 1:176067580-176067602 AGGAGGATAGAGTGGGAAAGTGG - Intronic
918789066 1:188801941-188801963 AAGAGGAGAAACTGGGAAGGGGG + Intergenic
919637295 1:200015197-200015219 AGGAGGAGAGGGAGGGAAGGAGG + Intergenic
919651497 1:200153798-200153820 AGGGGGAGATAGAGGGATGGAGG + Intronic
919840414 1:201605216-201605238 GAGAGGATGGAGAGGGAAGGTGG - Intergenic
919943205 1:202302480-202302502 AATAGGAGATGGTGGGAAGGAGG + Intronic
920039743 1:203087678-203087700 GACAGGAAATGGAGGGAAGGAGG + Intergenic
920250668 1:204620226-204620248 AAGAGGATGCAGAGTTAAGGAGG + Exonic
920387688 1:205580217-205580239 GAAAGGAGAGAGAGGGAAGGAGG - Intronic
920683705 1:208092933-208092955 AAGAGAACAAAGAGGGAAGGTGG + Intronic
920789990 1:209080841-209080863 AGGAGGTAATAAAGGGAAGGAGG - Intergenic
920837245 1:209522543-209522565 TAGAGGAGATAAAGGGAAGGGGG + Intergenic
921337909 1:214107204-214107226 AAGGAGATATAGGGGGTAGGGGG + Intergenic
921885271 1:220298859-220298881 AAGAGCATATAGATGAGAGGTGG + Intergenic
922068553 1:222168483-222168505 AAGAGAAGGAAGAGGGAAGGAGG + Intergenic
922095603 1:222440503-222440525 AAGAGGAGGGAGAGGGAAGGAGG + Intergenic
922707575 1:227797316-227797338 AAGAGGACACAGGAGGAAGGTGG + Intergenic
922756163 1:228098020-228098042 AAGAGGAGTGAGAGGGAGGGGGG - Exonic
922974202 1:229770090-229770112 AAGGGGAGATGGAGGGAGGGAGG - Intergenic
923127730 1:231047188-231047210 AAGGGGTTATGGAGGGAAGGAGG - Intergenic
923487169 1:234444667-234444689 AAGAGGAGATAGAGTGAGGGTGG - Intronic
924114798 1:240734704-240734726 AGGAGGAAATGGTGGGAAGGGGG - Intergenic
924123342 1:240824768-240824790 AAGAGGAAATAAAGGTTAGGTGG + Intronic
924444815 1:244119367-244119389 GAGAGGAGATGGAGGAAAGGAGG + Intergenic
924514771 1:244756678-244756700 AAGAGAATTCAGAGGGGAGGAGG + Intergenic
1063296366 10:4810811-4810833 AGGAAGAGAAAGAGGGAAGGAGG + Intronic
1063789631 10:9427552-9427574 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1064146045 10:12827162-12827184 GAGAGAAGAGAGAGGGAAGGAGG - Intronic
1064222739 10:13455607-13455629 AACAGGATACAGGGAGAAGGAGG + Intronic
1064303135 10:14140697-14140719 ACAAGCATATAGAGGGAAGATGG - Intronic
1064405548 10:15059124-15059146 AAGGGGAGAGGGAGGGAAGGGGG - Intronic
1064667022 10:17664422-17664444 AAGAGGAGCTGGAGGAAAGGGGG - Intronic
1065178164 10:23098539-23098561 AAGAGAATGTAGAGGGAATCTGG + Intronic
1065234369 10:23633519-23633541 CAGAGGATGTAGATGGGAGGGGG - Intergenic
1065319459 10:24495627-24495649 AAGAGGACTTAGGGGGAAGAAGG + Intronic
1065391791 10:25189890-25189912 AAGAACAGAAAGAGGGAAGGGGG + Intronic
1065484814 10:26227527-26227549 AAGAGGCTGGAGAAGGAAGGAGG - Intronic
1065874183 10:29982969-29982991 AAGGGGAGAGGGAGGGAAGGAGG + Intergenic
1065897280 10:30175111-30175133 AAGAGGGTATGAAGGGAAGTTGG - Intergenic
1066006834 10:31153636-31153658 AGGAGCATATAGAGAAAAGGAGG + Intergenic
1067576746 10:47413948-47413970 AGGAGGCTCTAGAGGGCAGGAGG + Intergenic
1067576750 10:47413965-47413987 AGGAGGCTCTAGAGGGCAGGAGG + Intergenic
1067908608 10:50320757-50320779 AAGTGGAGATAGAGGGAGGAAGG - Intronic
1067968744 10:50944316-50944338 AAGGGAATATATAGGGAAAGAGG + Intergenic
1068119568 10:52772026-52772048 AAGAGGACATGGAGAGAAAGAGG - Intergenic
1068161494 10:53271222-53271244 AGGCAGATATAGAGGAAAGGGGG + Intergenic
1068620070 10:59172916-59172938 AATAGGATGTAGGGGAAAGGTGG - Intergenic
1068659851 10:59612640-59612662 CAGAGGTAAGAGAGGGAAGGTGG - Intergenic
1069200381 10:65607768-65607790 AAGAAGAGAGAGAGGGAGGGAGG - Intergenic
1069679665 10:70274937-70274959 CAGAGGATCTAGGAGGAAGGAGG + Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069853050 10:71422984-71423006 AAGGGGAGAGAGAGGGAAAGAGG - Intronic
1069915570 10:71784684-71784706 AAGAGGATGATGAGGGAAGCAGG - Intronic
1071229785 10:83572110-83572132 GAGAGGAAAGAGAGGGAAGAAGG + Intergenic
1071867057 10:89746377-89746399 AAGGGGATGGAGCGGGAAGGTGG + Intronic
1071887589 10:89967841-89967863 AAGAGGAAAAAGAGGAAAGAAGG - Intergenic
1072276307 10:93826696-93826718 AACAGAAAATAGAGAGAAGGCGG - Intergenic
1072813049 10:98478389-98478411 AAGAGGAAACAGGGGGAATGGGG + Intronic
1073826199 10:107325016-107325038 AAGATGATATATAGGGAGGAAGG - Intergenic
1073860573 10:107733387-107733409 TAGAGGACATAGGAGGAAGGAGG + Intergenic
1073916486 10:108410393-108410415 AAGGGGATGTAGTAGGAAGGGGG - Intergenic
1073944012 10:108730091-108730113 GGAAGGAGATAGAGGGAAGGAGG + Intergenic
1073981601 10:109160386-109160408 ATGAGAATATAGAGGGAGTGGGG - Intergenic
1074013458 10:109508097-109508119 AAGCAGATAGAGAAGGAAGGAGG + Intergenic
1074401201 10:113142337-113142359 AAGGGGAGAGGGAGGGAAGGTGG + Intronic
1074728919 10:116347536-116347558 AAGGCGATGTAGAGGGAAGGAGG + Intronic
1075908031 10:126099393-126099415 AGGTGGATAGAGAGGGAGGGAGG - Intronic
1076324583 10:129611345-129611367 AAGAAGAGAGAGAGTGAAGGGGG + Intronic
1076444504 10:130503250-130503272 AAGGGGAGAAGGAGGGAAGGGGG - Intergenic
1076846384 10:133071463-133071485 AAGAAGGGAGAGAGGGAAGGAGG - Intronic
1076990815 11:272615-272637 AAGAGGACAAAGACGGAGGGAGG + Intergenic
1077480930 11:2814232-2814254 ATGCAGAGATAGAGGGAAGGAGG + Intronic
1077531316 11:3096963-3096985 AAGAGGAAAGAGGGGGAAGGTGG + Intronic
1077531325 11:3096995-3097017 AAGAGGAAAGAGGGGGAAGACGG + Intronic
1077531350 11:3097084-3097106 AAGAGGAAAGAGGGGGAAGATGG + Intronic
1077841165 11:5976196-5976218 AAGAATAAAAAGAGGGAAGGAGG + Intergenic
1078080539 11:8201593-8201615 AAGAAGATATAATGAGAAGGAGG - Intergenic
1078316546 11:10298098-10298120 AAGACGAAATAGATGGAATGCGG + Intergenic
1078361394 11:10670812-10670834 ATGAGGACACAGAGAGAAGGTGG + Intronic
1078532886 11:12150638-12150660 TGGAGGATATAGAGGGATGCTGG - Intronic
1078989705 11:16634411-16634433 AAGAGGAGAAAGAGAGAATGGGG + Intronic
1079594766 11:22229121-22229143 GAGAGGACATGGAGAGAAGGTGG - Intronic
1079826455 11:25201186-25201208 AAGAGGAGAAGGAGGGAAGGAGG + Intergenic
1079938104 11:26642880-26642902 AAGAAGAAATAGAGGGAAGATGG - Intronic
1081590379 11:44418760-44418782 AAAAGGACTGAGAGGGAAGGAGG - Intergenic
1081742037 11:45447727-45447749 AATAGGAAATGGAGGGCAGGAGG + Intergenic
1082218039 11:49598550-49598572 ATAAAGATAGAGAGGGAAGGAGG - Intergenic
1082710510 11:56548860-56548882 AAGAGGAAATAGAGGTATGCAGG + Intergenic
1084230229 11:67746935-67746957 AAAAGGATAGAAAGGGATGGAGG + Intergenic
1084596513 11:70119915-70119937 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
1084604709 11:70165700-70165722 AGGAGGACACAGAGGGAAGGTGG + Intronic
1085473687 11:76774367-76774389 AAGAGGAAAAAAATGGAAGGTGG - Intergenic
1085983645 11:81757012-81757034 AAGAAGAAAGAGAAGGAAGGAGG + Intergenic
1086116549 11:83257378-83257400 AAGAGAAAATAGAGGCAAGTAGG + Intronic
1086631535 11:89025645-89025667 ATAAAGATAGAGAGGGAAGGAGG + Intronic
1087058625 11:93957218-93957240 AAGAGAAAAGAGAGAGAAGGAGG + Intergenic
1087475039 11:98623807-98623829 AAGGGGATAGAGTGGGAAGGTGG + Intergenic
1087970140 11:104470429-104470451 AAGAGGATCGAGATGGAAGAAGG + Intergenic
1088073337 11:105816363-105816385 AACAGGATCAAGAGGGATGGTGG - Intronic
1088257743 11:107916783-107916805 AGGAGGATGGAGTGGGAAGGTGG - Intronic
1088613134 11:111598454-111598476 AAGAGGAGAAAGAGGGAGAGAGG + Intergenic
1089180183 11:116578238-116578260 AAGAAGAAATGGAGGGAGGGAGG - Intergenic
1090837160 11:130462050-130462072 AAGAGGACTGAGAGGGCAGGAGG - Intronic
1091045118 11:132318473-132318495 AAGAGGATGTAAAGGGACTGTGG - Intronic
1091050003 11:132358834-132358856 AAGAGAAGAGAGAGGGACGGGGG - Intergenic
1091285672 11:134407401-134407423 AAGAAGACCTAGAGGGATGGGGG - Intronic
1091665157 12:2413670-2413692 ATGAGGTTATGGAGGGACGGCGG - Intronic
1092205683 12:6613232-6613254 GAGAGGAAATGGAGGGGAGGGGG + Intergenic
1092857137 12:12684782-12684804 AAGAAAATAGAGAAGGAAGGAGG - Intronic
1093022685 12:14218198-14218220 AAGAGGATATTGTGGCCAGGTGG - Intergenic
1093204661 12:16232971-16232993 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
1093384469 12:18534626-18534648 AAGACTATATAAAAGGAAGGTGG + Intronic
1093803306 12:23400376-23400398 TTGAGAAGATAGAGGGAAGGTGG - Intergenic
1093920740 12:24856583-24856605 GAGAGGACATAGGGAGAAGGTGG + Intronic
1095131929 12:38553127-38553149 GAGAGGAGATGAAGGGAAGGGGG - Intergenic
1095540571 12:43304510-43304532 AATAGGATATCTTGGGAAGGGGG - Intergenic
1095619804 12:44238372-44238394 AAGGGAAAATAGAAGGAAGGAGG + Intronic
1095700907 12:45190035-45190057 AAGAAGGGAAAGAGGGAAGGAGG - Intergenic
1095700920 12:45190071-45190093 AAGAAGGGAAAGAGGGAAGGAGG - Intergenic
1095854799 12:46848792-46848814 AAGAGGAAATAAGGGGAAGAAGG + Intergenic
1096120289 12:49084558-49084580 GTGAGGACATAGAGAGAAGGTGG - Intergenic
1096146507 12:49282531-49282553 AATGGGAGAGAGAGGGAAGGGGG - Intergenic
1096717235 12:53499070-53499092 AGGAAGAGAGAGAGGGAAGGAGG - Intronic
1097149798 12:56968274-56968296 AAGAGGATATCGCGGCCAGGTGG + Intergenic
1097440258 12:59599204-59599226 AAGCAGAACTAGAGGGAAGGAGG + Intronic
1097542969 12:60963117-60963139 AAGAAGAAAGAAAGGGAAGGTGG + Intergenic
1097622730 12:61961136-61961158 AGGAGGAAAGAGAGAGAAGGTGG + Intronic
1098105463 12:67065410-67065432 AAGAGGAAAAAAAGGCAAGGGGG + Intergenic
1098333547 12:69379356-69379378 AAGAGGAGATAGAGAGAGAGAGG - Intronic
1098567961 12:71956592-71956614 AAGGAGAGAAAGAGGGAAGGAGG - Intronic
1098619544 12:72577516-72577538 CAGAGGATATAGAAGGACTGAGG + Intronic
1098649705 12:72949740-72949762 AACAGGACAAAGAGTGAAGGAGG + Intergenic
1098688075 12:73451051-73451073 AAAAGGATGTAGAGGGTTGGGGG + Intergenic
1099653279 12:85456723-85456745 AAGGGGATGGAAAGGGAAGGTGG - Intergenic
1099769705 12:87035276-87035298 GAGAGGAAATAGAGGGATGGAGG + Intergenic
1100286687 12:93173502-93173524 AAGAGGTAAGAGAGAGAAGGGGG + Intergenic
1100631961 12:96399330-96399352 GAGCGGAGGTAGAGGGAAGGTGG - Intronic
1100985347 12:100198196-100198218 AAGAGGAATGAGAGAGAAGGTGG + Intergenic
1100991356 12:100254708-100254730 AAGAAGAAAGAGAGGGAAGGAGG - Intronic
1101047124 12:100820057-100820079 AAAGGGAAATAGAGGGAGGGAGG - Intronic
1101377569 12:104184173-104184195 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
1101388155 12:104276177-104276199 AAGAGGATGTTGAAGAAAGGTGG + Intronic
1101925051 12:108964808-108964830 AAGAAGGGAGAGAGGGAAGGAGG - Intronic
1102703315 12:114859289-114859311 AAGAGGAAGTAGAGGCAAGGGGG - Intergenic
1103083148 12:118041314-118041336 ATGAGGATGCAGAGAGAAGGTGG + Intronic
1103153812 12:118665849-118665871 AACATGAAATTGAGGGAAGGTGG + Intergenic
1103594917 12:122019048-122019070 AGGAAGAAAAAGAGGGAAGGAGG - Intergenic
1103652436 12:122443415-122443437 AAGAAGAAAGAAAGGGAAGGAGG - Intergenic
1103684889 12:122724109-122724131 AAAATGACATAGAGGGAGGGGGG - Intergenic
1104772872 12:131375153-131375175 AACAGGAAAGAGAGGGATGGAGG + Intergenic
1105634973 13:22208119-22208141 AAGAGGACATGGTGGGGAGGAGG - Intergenic
1106456370 13:29930752-29930774 GGGAGGATATAAAGGGAAGAGGG + Intergenic
1106506651 13:30376342-30376364 ACAAGGATGTGGAGGGAAGGGGG + Intergenic
1106683778 13:32035136-32035158 AAGTGGATTTAGAAGGGAGGAGG - Intronic
1106942290 13:34792296-34792318 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
1106956153 13:34941968-34941990 AAGAGGATATTGAGAGAAGGAGG + Intergenic
1106962150 13:35011089-35011111 CAGAGGACATAGGTGGAAGGTGG + Intronic
1107763663 13:43710145-43710167 GAGAGGAAAAAGAGGGCAGGAGG + Intronic
1108165980 13:47693530-47693552 ATGAGGAAAGAGAGGGAGGGAGG - Intergenic
1108551573 13:51551025-51551047 AAGAGAAGATAGAGTGAAGGTGG - Intergenic
1108690357 13:52853945-52853967 ATGAGGACACAGAGAGAAGGCGG - Intergenic
1108895527 13:55322630-55322652 AAGAAAAAATAGAAGGAAGGAGG - Intergenic
1109004992 13:56862350-56862372 CAGATGATGCAGAGGGAAGGAGG - Intergenic
1109576879 13:64271214-64271236 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1109943631 13:69404505-69404527 AAGAGGATGGAGTGGGAATGTGG - Intergenic
1110071334 13:71182602-71182624 AAGGGGATAGAGTGGGAAGGTGG + Intergenic
1110088324 13:71411118-71411140 AAGTGGAAATATTGGGAAGGAGG - Intergenic
1110190269 13:72722428-72722450 AAAAGGAAAAAGAGGGAAAGTGG - Intronic
1110433903 13:75458222-75458244 AAGAGGATGGAGTGGGAAGATGG + Intronic
1110538108 13:76676036-76676058 AAGAGTATATTGTGGAAAGGGGG + Intergenic
1111021820 13:82460206-82460228 AAGAGGATATCGTGGCCAGGTGG - Intergenic
1111363975 13:87216320-87216342 AAGAGAATAAAGAAGGAAAGAGG - Intergenic
1111639498 13:90948839-90948861 AAGAGGAAATAGAGAGATTGGGG + Intergenic
1111666792 13:91279432-91279454 AAAAGGATATAGTAAGAAGGTGG - Intergenic
1111856231 13:93640871-93640893 AAAAAGATAAAGAGGGAAGAAGG - Intronic
1112169497 13:96955974-96955996 AAGAGGAAAAAGTGGGAATGAGG + Intergenic
1112358722 13:98696933-98696955 GTGAGGACCTAGAGGGAAGGTGG + Intronic
1112368967 13:98778158-98778180 AAGGGGATACAGACGGAAGGTGG + Intergenic
1112607915 13:100926116-100926138 AAGAGGATCTAGAGGGAGATGGG - Intergenic
1113024191 13:105922211-105922233 AAGAAGAAATGGAGGGAAGAGGG - Intergenic
1113671369 13:112177814-112177836 AAGACGATCAACAGGGAAGGAGG + Intergenic
1113754854 13:112804036-112804058 AGGAGGAAAAGGAGGGAAGGAGG - Intronic
1114428450 14:22640159-22640181 AAGAATATGTATAGGGAAGGGGG + Intergenic
1114576483 14:23719114-23719136 AAGAGGAAAAAGAGAGAAGAAGG + Intergenic
1114996934 14:28365472-28365494 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
1115225924 14:31102176-31102198 AAAAGAATATGGTGGGAAGGGGG + Intronic
1115522178 14:34243935-34243957 AAGAAGATATAGTGGGAGGTGGG - Intronic
1116027741 14:39535543-39535565 AAGAGGCTACGGAGAGAAGGTGG - Intergenic
1116277894 14:42860215-42860237 CAGAGGATGCAGAGGGAAGAGGG + Intergenic
1117213081 14:53521631-53521653 AATAGGATAGAGAGTGGAGGGGG - Intergenic
1117574937 14:57088359-57088381 AAGAGGAGAGAAATGGAAGGGGG + Intergenic
1118247793 14:64128256-64128278 GGGAGGATGTAGAGGGAAGAAGG + Intronic
1118321716 14:64757362-64757384 AAGAGGAAACAGAAGAAAGGTGG - Intronic
1118509043 14:66450176-66450198 CAGAGCTTATAGATGGAAGGTGG + Intergenic
1119517592 14:75260401-75260423 CAGAGGAGATAGAGGAAAGGAGG - Intronic
1119861851 14:77941752-77941774 ATGAGGACATAGTGAGAAGGTGG + Intergenic
1119992436 14:79214193-79214215 TAGAATATATAGAGAGAAGGTGG + Intronic
1120523273 14:85549050-85549072 AAGGGGATGGAGTGGGAAGGTGG - Intronic
1120651369 14:87137538-87137560 AAGAGGAAATAGTGGGAACTGGG - Intergenic
1121509250 14:94500262-94500284 AAGAGGATCTATTGGGAAGCTGG - Intronic
1121561964 14:94882573-94882595 ATGAGGATACAGGGAGAAGGCGG + Intergenic
1121578723 14:95010396-95010418 AAAAAGAAACAGAGGGAAGGAGG + Intergenic
1121828396 14:97029177-97029199 AAGAGAAGAAAGAGGGAAGAAGG - Intergenic
1121880598 14:97497148-97497170 AAGAGGAGAGTGAGGGATGGGGG + Intergenic
1122821193 14:104346008-104346030 AAGAGGGCCTGGAGGGAAGGAGG - Intergenic
1123706404 15:22954200-22954222 GAGAGGACACAGAGAGAAGGTGG + Intronic
1124501718 15:30233788-30233810 AAGAGGAAAAAGAGGGGAGAAGG - Intergenic
1124741847 15:32304863-32304885 AAGAGGAAAAAGAGGGGAGAAGG + Intergenic
1125073410 15:35583858-35583880 AACTGAATATAGAGGGAAAGGGG - Intergenic
1125200621 15:37098316-37098338 AAGATGAGAGAGAGGGAGGGAGG + Intronic
1125213610 15:37243764-37243786 AAGAGGAAATGGTGGGAAGGAGG + Intergenic
1125605824 15:40939321-40939343 GAGGGCATAAAGAGGGAAGGGGG - Intergenic
1126617726 15:50602783-50602805 AAGGGGATGTAAAGGGAAGCTGG + Intronic
1126652165 15:50935411-50935433 AAGAGTAAGTTGAGGGAAGGGGG + Intronic
1127074430 15:55311712-55311734 AAGAGGATATCGTGGCCAGGTGG + Intronic
1127375964 15:58384538-58384560 ATGAGGATACAGTGAGAAGGTGG - Intronic
1127706388 15:61551335-61551357 AAAAGGATATTCAGGGTAGGTGG - Intergenic
1128891527 15:71336071-71336093 AAGAGGAAATAAAGTGATGGAGG + Intronic
1130077854 15:80705108-80705130 AAGAGGCAAGAGAGGGAAGATGG + Intronic
1130118859 15:81029353-81029375 ATGAGGATAAGGAGTGAAGGAGG + Intronic
1130155014 15:81342886-81342908 AGGAGGAAATGGAGGGAGGGTGG + Intronic
1130207168 15:81887867-81887889 CAGAGGATATTGAGGGAGAGAGG - Intergenic
1130561748 15:84964309-84964331 AAGAAGAGAAACAGGGAAGGAGG + Intergenic
1131646242 15:94348389-94348411 GAGGGGATGGAGAGGGAAGGGGG - Intronic
1132154559 15:99486484-99486506 AAGAGGACAGAGGGCGAAGGCGG - Intergenic
1132212345 15:100033794-100033816 AAGAGAATATAGAAAGAATGTGG - Intronic
1132571033 16:644073-644095 AAAAAGAAACAGAGGGAAGGTGG - Intronic
1133813326 16:9177904-9177926 AAGAGGACACAGCAGGAAGGTGG - Intergenic
1134557413 16:15177384-15177406 AAAAGGAAAGAGAGGGAGGGAGG + Intergenic
1134906572 16:17984669-17984691 GAGAGGGGAAAGAGGGAAGGGGG - Intergenic
1134917983 16:18089063-18089085 AAAAGGAAAGAGAGGGAGGGAGG + Intergenic
1135005385 16:18817495-18817517 AAGAGGAGATGGGAGGAAGGTGG + Intronic
1135115784 16:19722456-19722478 AAGAGGATATAGGGTCATGGTGG - Intronic
1135927654 16:26709744-26709766 AAGAGGGAAGGGAGGGAAGGAGG + Intergenic
1136285576 16:29238493-29238515 AAGAAGAGATGGAGGGAGGGAGG + Intergenic
1137411665 16:48233476-48233498 AAGAGAAAAGAGAGAGAAGGAGG + Intronic
1137498303 16:48988901-48988923 AAGAAGGAATGGAGGGAAGGAGG - Intergenic
1137857185 16:51806740-51806762 ATGAGGATATAGTGAGAAGATGG - Intergenic
1137968378 16:52959217-52959239 AAGAAGAAATAGAAAGAAGGAGG - Intergenic
1138699897 16:58851537-58851559 ATGAGGAAATAGAGGCAAAGAGG + Intergenic
1138988513 16:62361525-62361547 AAGGGGAGAGAGAGGGAGGGAGG + Intergenic
1139195394 16:64912697-64912719 TAGAAGATAAAGAGGGACGGGGG + Intergenic
1139272422 16:65696721-65696743 AAGAGGAAAGAGAAAGAAGGAGG + Intergenic
1139329640 16:66177327-66177349 ATGAGGATACAGTGAGAAGGTGG - Intergenic
1139341029 16:66267931-66267953 AAAAGGAAAAGGAGGGAAGGAGG + Intergenic
1140903612 16:79392330-79392352 GAGAGGAGAGAGAAGGAAGGAGG + Intergenic
1141014122 16:80431855-80431877 AAGAGAAAAGAGAGGTAAGGTGG - Intergenic
1141026213 16:80551267-80551289 AAGAGGATATAAAGCAAATGTGG - Intergenic
1141051042 16:80763945-80763967 AAGGGGGTAGAGAGGGAAAGAGG + Intronic
1141998625 16:87650368-87650390 CAGAGGAGAGAGAGGGATGGGGG - Intronic
1142090909 16:88208645-88208667 AAGAAGAGATGGAGGGAGGGAGG + Intergenic
1142993299 17:3746248-3746270 AAGAGAATGGAGAGGGAAAGAGG + Intronic
1143197600 17:5087941-5087963 AAGAAGATCTAGAGGGAAAATGG + Intronic
1143391325 17:6560943-6560965 AAGAGGAGGAAGAGGGGAGGAGG - Intergenic
1143391519 17:6561619-6561641 AAGAGGAGGAAGAGGGAAGGAGG - Intergenic
1143614595 17:8042345-8042367 TGGAGGGTAGAGAGGGAAGGTGG - Intronic
1144247757 17:13384356-13384378 AAGGGGGGAGAGAGGGAAGGAGG + Intergenic
1144302854 17:13939077-13939099 AAGGGGATGGAGTGGGAAGGCGG - Intergenic
1145302729 17:21652596-21652618 CAGAGGAGACAGAGGGCAGGAGG - Intergenic
1145347574 17:22050592-22050614 CAGAGGAGACAGAGGGCAGGAGG + Intergenic
1145398884 17:22515553-22515575 AAGAGGAGAAAGAAGGAAGAAGG + Intergenic
1146700578 17:34956166-34956188 AAGAGGCTGGAGAGGGAAGTGGG - Intronic
1146925255 17:36740066-36740088 AAGAGGGAAGAGAGGGAGGGAGG + Intergenic
1147242381 17:39099022-39099044 AACAGGAGACAGAGGGAAGGAGG + Intronic
1147317185 17:39626692-39626714 GAGAGGATAAAGGGGGAGGGAGG - Intergenic
1147661650 17:42120134-42120156 AAGGGGGCATAGAGGGGAGGGGG + Intronic
1147725575 17:42564408-42564430 AAGGGTAAAAAGAGGGAAGGAGG - Intronic
1148467554 17:47873959-47873981 AAGAAGAAAGAGAGGAAAGGAGG - Intergenic
1149161217 17:53695307-53695329 AAGAGAATTTAGAGGAAAAGTGG - Intergenic
1149161682 17:53701240-53701262 AAGAGGACATAAACAGAAGGTGG - Intergenic
1149360463 17:55889617-55889639 AAGAGGAAGAAGAGGGAAGCTGG - Intergenic
1149457258 17:56797986-56798008 TAGAAGATGGAGAGGGAAGGAGG - Intronic
1149564872 17:57634000-57634022 AAGAGGGAAGAGAGGGAAGGAGG - Intronic
1149749335 17:59129934-59129956 AAGGAGAGAAAGAGGGAAGGAGG + Intronic
1149815068 17:59715398-59715420 AAGAGAAAATAGTGTGAAGGAGG + Intronic
1150431470 17:65121819-65121841 AAAAGGAAAGAGAGGGAGGGAGG - Intergenic
1150432767 17:65131668-65131690 AACAGGAGATGGAGGGCAGGAGG + Intergenic
1150446418 17:65230139-65230161 AAGAGGCAATGGTGGGAAGGTGG + Intergenic
1150623439 17:66825006-66825028 GAGAGGCTATTGAGAGAAGGAGG - Intergenic
1150810283 17:68350841-68350863 GAGAAGAGATAGAAGGAAGGAGG + Intronic
1151163916 17:72188152-72188174 AGGAGAAGAGAGAGGGAAGGAGG + Intergenic
1151244702 17:72785418-72785440 AAGAAGATATTGAGGAAAGGTGG + Intronic
1151283892 17:73096096-73096118 AAGAGGATATAAAGATAAAGTGG - Intergenic
1151326405 17:73382379-73382401 TAGAGGATATTTAGGGAAGGAGG + Intronic
1151652103 17:75476398-75476420 AAGAGGAAAGAGAAGGAGGGAGG - Intronic
1152320819 17:79608202-79608224 AGGCGGATGTCGAGGGAAGGTGG - Intergenic
1152598345 17:81249179-81249201 AAGAGGAGACAGAAGGGAGGAGG + Intronic
1153590451 18:6669090-6669112 GAGAGGAGAGGGAGGGAAGGAGG + Intergenic
1153764838 18:8365629-8365651 AAGAGGAGAGAGAGGGAGAGAGG - Intronic
1153786251 18:8537705-8537727 ATGAGGAGATAGAGGGAGCGAGG - Intergenic
1153927488 18:9846949-9846971 AGGAGGAAAGAAAGGGAAGGTGG - Intronic
1155263089 18:24063965-24063987 AAGAAGTTAAAGAGGCAAGGTGG - Intronic
1155384412 18:25261588-25261610 AAGGGGATAGAAAGTGAAGGAGG - Intronic
1155513569 18:26601139-26601161 ATGAGCATTTAGAGGGAAGCAGG + Intronic
1155797377 18:30057508-30057530 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1155797391 18:30057603-30057625 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
1155917779 18:31572980-31573002 GAGAGGAAAGAGAGGGAAGGAGG + Intergenic
1156289140 18:35730364-35730386 GAGAGGAGAAAGTGGGAAGGGGG - Intergenic
1157289927 18:46402311-46402333 AATCAGATTTAGAGGGAAGGAGG - Intronic
1157405493 18:47419273-47419295 AAGAGGAGATAGGGGGAAGGAGG + Intergenic
1157574649 18:48735573-48735595 AAAAGGGGAAAGAGGGAAGGAGG + Intronic
1157812123 18:50704759-50704781 AAGAGGATGCAGAGGCAGGGAGG - Intronic
1158184816 18:54759862-54759884 AAGGGGATGGAGTGGGAAGGTGG - Intronic
1158317910 18:56231910-56231932 AAGCAGATAGCGAGGGAAGGAGG + Intergenic
1158582538 18:58697138-58697160 AGGAGGATAGAGAGGGATGGGGG - Intronic
1158641594 18:59208177-59208199 AGGAGGAAATGGAGGGAGGGAGG + Intergenic
1159088732 18:63822668-63822690 AAGAGGAAGTAGAAGAAAGGAGG - Intergenic
1159103524 18:63980779-63980801 AAGAGGATATAGAGGGAAGGAGG - Intronic
1159172240 18:64785853-64785875 AGCAGGAAATAGAGCGAAGGGGG - Intergenic
1159703802 18:71662040-71662062 AAGAAGAGAGAGAGTGAAGGGGG - Intergenic
1159707899 18:71715962-71715984 AACAGGAGATAGAGGCTAGGTGG + Intergenic
1159850655 18:73523297-73523319 AAGAAGAGAGAGAGGAAAGGAGG + Intergenic
1159921178 18:74228617-74228639 ATGAGGACATAGAGACAAGGTGG + Intergenic
1160041758 18:75351975-75351997 ATGAGGACACAGAGAGAAGGTGG + Intergenic
1160299736 18:77668888-77668910 AAGAGGAGAGAGGGGGACGGAGG + Intergenic
1161139694 19:2639993-2640015 AAGAAGAGAGGGAGGGAAGGAGG + Intronic
1161754153 19:6119386-6119408 AAGAAGGAATGGAGGGAAGGAGG - Intronic
1162119917 19:8458161-8458183 AAGAGGATCAAGAGTGAGGGAGG - Intronic
1162151964 19:8652804-8652826 AAGAAGAGAGAGAGAGAAGGAGG - Intergenic
1162671289 19:12259935-12259957 AAGAGGACAGGGAGGGAAGGTGG - Intronic
1162972861 19:14191620-14191642 GTGAGGATATAGTGAGAAGGCGG - Intronic
1163347948 19:16756361-16756383 AAGAGGAGGAAGAGGGGAGGAGG + Intronic
1163415479 19:17183962-17183984 AGGGGGAGATAGTGGGAAGGAGG - Intronic
1164250127 19:23468686-23468708 AAGAGGAGAAGGAGGGAAGAAGG - Intergenic
1164250206 19:23469157-23469179 AAGAGGAGAAAAAGAGAAGGAGG - Intergenic
1164292586 19:23881178-23881200 AGGAGGAGAAAGAGGGGAGGAGG + Intergenic
1164485388 19:28651443-28651465 AAGAGGGTATAGAGGAGAGGGGG + Intergenic
1164542058 19:29128660-29128682 AAGAGGATATAAAGACATGGAGG + Intergenic
1164563089 19:29307675-29307697 AGGAGGAAGAAGAGGGAAGGTGG - Intergenic
1164802692 19:31090752-31090774 AAGGGGAGACAGAGAGAAGGAGG + Intergenic
1164861676 19:31566706-31566728 AAAAGAAAAAAGAGGGAAGGAGG + Intergenic
1166008624 19:39925126-39925148 AAGAAGAAGAAGAGGGAAGGGGG + Intronic
1166594598 19:44034361-44034383 CAAAGGAGATAGAGAGAAGGAGG + Intergenic
1166649373 19:44560138-44560160 AAAAGGAGAAAGAGGGAGGGAGG + Intergenic
1166872734 19:45880740-45880762 AAGGGGATAAAGAGTGATGGGGG - Intergenic
1167051306 19:47080384-47080406 TAGAGAAAATAGAGGGAAGTTGG - Intronic
1167601129 19:50455470-50455492 AAGAGGATATGGGGGGAATGAGG - Intronic
1167608146 19:50492729-50492751 AAGAGGAAAGAGGAGGAAGGGGG + Intergenic
1167641674 19:50686050-50686072 AAGGGGATAAGGAGGAAAGGAGG + Intronic
1167684578 19:50948797-50948819 AAGTGGAGAAAGATGGAAGGCGG + Intronic
1167752975 19:51391765-51391787 AAGAGGATATAGAGTCACCGAGG + Intergenic
1167850168 19:52195182-52195204 AGGTGCATATAGTGGGAAGGCGG + Intronic
1167859423 19:52270794-52270816 AAGAAGGAATAGAGGGAAGAAGG + Intronic
925217561 2:2110587-2110609 AGGAGGAAATAGAGGGAGGGAGG - Intronic
925436871 2:3846118-3846140 AAGAGGACGAGGAGGGAAGGAGG - Intronic
925460031 2:4054042-4054064 GAGAGGATCCAGAGGCAAGGCGG - Intergenic
925736616 2:6969381-6969403 AAGATGATATAAAGAGAAGACGG + Intronic
925808287 2:7673802-7673824 AAGAGCATATTGAGGCAAAGAGG - Intergenic
925852723 2:8098671-8098693 AAGAGGATGTGGAGGTGAGGAGG - Intergenic
925869313 2:8255293-8255315 AAGAGAAGCTAGGGGGAAGGTGG - Intergenic
926026820 2:9552642-9552664 AAGAGGATGTAGTGGGTGGGAGG - Intronic
926092022 2:10057614-10057636 AAGGAGATAGAGGGGGAAGGAGG - Exonic
926542338 2:14196921-14196943 AAGAGGACAGAGAGGAAAGGAGG - Intergenic
926570575 2:14525355-14525377 AAGAGGAGAAGGAGGGAGGGTGG + Intergenic
927287269 2:21369826-21369848 AGGAGGTAATGGAGGGAAGGAGG - Intergenic
927528170 2:23767918-23767940 AACAGAATAGAGAGGAAAGGAGG + Intronic
927835747 2:26397396-26397418 AGGAGGAAAGAGAGGGGAGGAGG - Intergenic
927843981 2:26461997-26462019 GAGAGGAGGCAGAGGGAAGGTGG - Intronic
927964330 2:27259846-27259868 ACAATGATATAGAGCGAAGGTGG + Intronic
929425756 2:41843031-41843053 AAGAGGAAAGAGTGGGAAAGAGG + Intergenic
929442162 2:41972926-41972948 AAGAGGATAGGGAGGGATGTGGG - Intergenic
930033698 2:47072872-47072894 AAGAGGATGTAGAGGGGACAAGG + Intronic
930311876 2:49752370-49752392 AAGAGGGGAGAGAGGGAAAGAGG + Intergenic
930517644 2:52428558-52428580 TAGAAGATATAGAGGGGAGGAGG + Intergenic
930589830 2:53314001-53314023 AAGAAGAAAAGGAGGGAAGGAGG + Intergenic
930826544 2:55701412-55701434 AGAAGGAGAGAGAGGGAAGGAGG + Intergenic
931058010 2:58494434-58494456 AACAGGATAGAGAAGGAAGCGGG + Intergenic
931140709 2:59454630-59454652 AGGAGGAGATAGAAGGAAGCTGG + Intergenic
931617554 2:64175690-64175712 AGGAGGATAGAGAAGGCAGGAGG - Intergenic
932020288 2:68077771-68077793 AGGAGGACATGGTGGGAAGGTGG - Intronic
932061397 2:68502856-68502878 CAGAGGGTATAGAGAGAATGCGG - Exonic
932844755 2:75123700-75123722 AGGAGGAAAGAGAGGAAAGGAGG - Intronic
932917531 2:75874488-75874510 AAGAGGATATCGTGGCCAGGTGG - Intergenic
933141443 2:78795756-78795778 AGGAGGATGGAGTGGGAAGGTGG + Intergenic
933312428 2:80677354-80677376 AAGATGCTATAGAGGAATGGAGG + Intergenic
933462900 2:82612136-82612158 AAGGGGATAGAGTGGAAAGGTGG - Intergenic
933493622 2:83019909-83019931 GTGAGGACATAGAGAGAAGGTGG - Intergenic
934913342 2:98278557-98278579 AAGGGGATGGAGTGGGAAGGTGG + Intronic
934932863 2:98442490-98442512 AAGAGGAAAAAGTGGGCAGGAGG + Intergenic
935283753 2:101545138-101545160 AAGGGGAAAGAGTGGGAAGGAGG - Intergenic
935297814 2:101665825-101665847 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
935609495 2:105006263-105006285 ATGAAGATATAGGGAGAAGGTGG - Intergenic
935787719 2:106563908-106563930 AAGAGGAAGGAGAGGCAAGGTGG + Intergenic
936453533 2:112651990-112652012 AAGAGGAGAGTGATGGAAGGGGG - Intronic
936925782 2:117735307-117735329 AAGTGGGGAGAGAGGGAAGGAGG + Intergenic
937140042 2:119592132-119592154 AAGAGGAGAAAGAGGGAGGCTGG + Intronic
937840397 2:126519055-126519077 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
938775852 2:134540536-134540558 AGGAGGAAGGAGAGGGAAGGTGG + Intronic
939010266 2:136838269-136838291 AATTGGGTATAGAGGGAAGGAGG + Intronic
939700663 2:145386830-145386852 AAGAGGATAGAATGGGAAGGTGG - Intergenic
939875025 2:147568215-147568237 ATGAGTATATGGAGGGATGGAGG + Intergenic
939985738 2:148827879-148827901 ATGAGGACACAGAGAGAAGGTGG + Intergenic
940787695 2:157999930-157999952 ATTAGGATAAAAAGGGAAGGAGG + Intronic
941036566 2:160575349-160575371 AACTGGAGATAGTGGGAAGGTGG - Intergenic
941232987 2:162934339-162934361 AAGAGGATGGGGAGGGAGGGAGG - Intergenic
941301093 2:163802238-163802260 AAGAGGAGGAAGAGGAAAGGAGG + Intergenic
941356875 2:164504634-164504656 ATGAGGCTGAAGAGGGAAGGAGG - Intronic
941561855 2:167056801-167056823 ATATGGATATGGAGGGAAGGAGG - Intronic
942650616 2:178163553-178163575 AAGTGGGGAAAGAGGGAAGGAGG + Intergenic
942707573 2:178793855-178793877 AAGAGGATAAGGAGGAAAGCTGG + Intronic
943065609 2:183082853-183082875 AAGAGAAGAGAGAGGGAGGGAGG - Intronic
943330758 2:186556300-186556322 AAGAAGGAATAGAGGGAGGGAGG - Intergenic
943496185 2:188623489-188623511 AAGTGGATTTAGGGGGCAGGAGG + Intergenic
943784386 2:191861103-191861125 AAGAGGACAGAGTGAGAAGGAGG - Intergenic
944406750 2:199393253-199393275 AAGAAGAAAAGGAGGGAAGGAGG + Intronic
944578617 2:201113422-201113444 AAGAGGATGTAAATGGAAAGTGG + Intergenic
944905317 2:204256380-204256402 AAAAAGAGATGGAGGGAAGGAGG + Intergenic
945047983 2:205798705-205798727 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
945139330 2:206667209-206667231 ATGAGGTCAGAGAGGGAAGGGGG - Intronic
945608222 2:211963608-211963630 AAGAGGAAAGAGAGGGAGAGAGG - Intronic
946090379 2:217217395-217217417 AAAATGAAAGAGAGGGAAGGAGG - Intergenic
946152154 2:217783270-217783292 AAGATGAGAGAGAGGGAAAGGGG - Intergenic
946210474 2:218143548-218143570 AGGAGGATGGAGTGGGAAGGTGG + Intergenic
946218923 2:218209542-218209564 AAGAGGAGAGAGAGAGAAAGGGG - Intergenic
946294611 2:218773966-218773988 AAGAAGAAAGAGAGGGAAGAAGG - Intergenic
946490735 2:220146643-220146665 AGGAGGATAGAGAGAAAAGGAGG - Intergenic
946519034 2:220446500-220446522 AAGTGGGGAAAGAGGGAAGGAGG - Intergenic
946962484 2:224999498-224999520 AAGAGGGGAGAGAGGGAGGGAGG - Intronic
947077016 2:226355732-226355754 AAGAGGAAGGAGAGGAAAGGAGG + Intergenic
947077058 2:226355992-226356014 AAAAAGAGACAGAGGGAAGGGGG + Intergenic
947625481 2:231615656-231615678 AAGAGGGTCGAGAGGGGAGGCGG - Intergenic
947833014 2:233155126-233155148 ATGAGGAGAAAGAGAGAAGGGGG + Intronic
1169316716 20:4597896-4597918 GAGAGGAGAGAGAGGGAGGGAGG - Intergenic
1169525964 20:6426141-6426163 AAGAGGAGAGAGAGAGAAGGGGG - Intergenic
1169541650 20:6606333-6606355 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
1169547508 20:6665671-6665693 AAGAAGAGATGGAGGGACGGAGG - Intergenic
1169901955 20:10562321-10562343 AGGGGGATCTAGTGGGAAGGTGG + Intronic
1170249096 20:14259843-14259865 TATGGGATATAGAGGGGAGGCGG + Intronic
1170268721 20:14499623-14499645 ATGAGGAAGAAGAGGGAAGGTGG + Intronic
1170822438 20:19765910-19765932 AGGAGGCTACAGAGGGAGGGAGG + Intergenic
1170839371 20:19911465-19911487 AGGAGGATTTAGAGATAAGGTGG - Intronic
1170893466 20:20395021-20395043 GGGAGGATAAAGAGGGAAAGAGG + Intronic
1171498612 20:25575890-25575912 TAGATGATATGGAGGGAGGGAGG - Intronic
1171519319 20:25764127-25764149 CAGAGGAGACAGAGGGCAGGAGG - Intronic
1171980883 20:31627925-31627947 AAGTAGACATAGAGGGAAGATGG + Intergenic
1172206216 20:33164618-33164640 AGAAGGAAAGAGAGGGAAGGAGG - Intronic
1172586640 20:36089925-36089947 AAGAAGAGAGAGAGGGAGGGAGG - Intergenic
1172932584 20:38597007-38597029 AAGAGGAAATTGTGGGTAGGTGG + Intergenic
1173002030 20:39111607-39111629 AGGAGGATAGAGAGGAGAGGAGG + Intergenic
1174076080 20:47937963-47937985 AATAGGATCAAGAGGGATGGAGG - Intergenic
1174111951 20:48203223-48203245 AAGAGGACAGAGGGGAAAGGAGG - Intergenic
1174359313 20:50017956-50017978 AAGAGGAGAAAGAGAGAAAGAGG - Intergenic
1174434545 20:50496710-50496732 AAAAGGAAAAAGAAGGAAGGAGG - Intergenic
1174680939 20:52407507-52407529 AGGAAGATGTAGAGGGAGGGCGG + Intergenic
1175052482 20:56168109-56168131 AAGAACAGAGAGAGGGAAGGAGG - Intergenic
1175221224 20:57417583-57417605 AAGATGAAATGGAGGGAGGGAGG + Intergenic
1175702217 20:61147811-61147833 GAGTGGATAGAGAAGGAAGGGGG + Intergenic
1175979971 20:62733765-62733787 CAGAGGAGAGAGAGGGGAGGAGG + Intronic
1176107363 20:63395728-63395750 AAGAGAGTAGAGAGGGAAGAAGG + Intergenic
1176670351 21:9728371-9728393 AAGAGCAAAGAGAGGGAAGAGGG + Intergenic
1177244249 21:18502219-18502241 CAGAGGAGATAGAGGGATGGAGG + Intergenic
1177321663 21:19529616-19529638 AAGAGGAGATAGAGGTACTGAGG - Intergenic
1177406609 21:20676166-20676188 AAGAGGAAATAGTGAGAACGTGG - Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1177896120 21:26857489-26857511 AAGAGGATATCGTGGCCAGGTGG - Intergenic
1178478708 21:32960062-32960084 ATCAGAAAATAGAGGGAAGGTGG - Intergenic
1178796882 21:35752935-35752957 AAGGGGAAAGATAGGGAAGGAGG + Intronic
1179570226 21:42274187-42274209 AAGGGAAAATACAGGGAAGGTGG + Intronic
1180108406 21:45634663-45634685 AAGGGGACGTAGTGGGAAGGAGG - Intergenic
1181898217 22:26129856-26129878 AAGAAGACAAAGAAGGAAGGAGG - Intergenic
1181901551 22:26160323-26160345 GAGAGGAAGTAGAGGGAAGGAGG + Intergenic
1182198429 22:28543528-28543550 AAGAAGAGAGAGAGAGAAGGAGG + Intronic
1182328424 22:29531863-29531885 AAGAGGACATAGAGGGGAGGCGG + Exonic
1182598088 22:31437736-31437758 AAGAGGATACACAGGAAAGGTGG + Intronic
1183119567 22:35719918-35719940 AAGGGGATGGAGTGGGAAGGTGG + Intronic
1184315409 22:43684346-43684368 AAGAGGCCATAGAGGGAAAGGGG - Intronic
1184976455 22:48065885-48065907 GAGGGAATATAGAGGGAAGCTGG + Intergenic
1185008290 22:48298758-48298780 AAGAAGATAGAGAGGCCAGGCGG + Intergenic
949785775 3:7740108-7740130 TAGAGTATAAAGAGGGAAGCTGG + Intronic
950314161 3:11985994-11986016 AAGAGGATAGAGAGAGAATCCGG - Intergenic
950943206 3:16915852-16915874 GAAAGGATAGAGAGAGAAGGAGG + Intronic
951409180 3:22341476-22341498 AAGAGAATATATGGAGAAGGAGG - Intronic
951837740 3:27001711-27001733 AAGAGGATATCGTGGCCAGGCGG - Intergenic
952566268 3:34662154-34662176 AAATGGATAAAGAGGAAAGGGGG + Intergenic
952609957 3:35196709-35196731 AAGAAGAAACAGAGGAAAGGAGG - Intergenic
952761442 3:36917962-36917984 TAGAGGAAATTGAGGGATGGAGG + Intronic
952909837 3:38174139-38174161 AAGAGGTTAGAAAGGTAAGGTGG + Intronic
953088370 3:39697343-39697365 AAGAGGATGTCGAGGGGAGCAGG + Intergenic
953340808 3:42132737-42132759 GAGAGGATATAGACAGAAGCAGG - Intronic
954073316 3:48158887-48158909 AAGAGGGTAAAGGGGGATGGAGG + Exonic
954442357 3:50528658-50528680 AAGAGGCTGGAGAGGGAATGTGG - Intergenic
954881235 3:53837378-53837400 AAGAGGATCCAGAGGGCAGGTGG - Intronic
954931165 3:54283171-54283193 AAGAGAATTGATAGGGAAGGTGG + Intronic
955011567 3:55021396-55021418 AAAGGGAGAGAGAGGGAAGGAGG - Intronic
956031016 3:65038020-65038042 AAGAGGATATAGGAGTAAAGAGG - Intergenic
956140238 3:66139035-66139057 AAGAGGATGGGGAGGGGAGGAGG - Intronic
956735281 3:72233267-72233289 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
956923987 3:73962614-73962636 AAGGGCATATAGAAGGAAAGAGG + Intergenic
956930190 3:74034810-74034832 AAGAAGAAATATAGGGAATGGGG - Intergenic
957046790 3:75381962-75381984 AAAAGGATAGAAAGGGATGGAGG + Intergenic
957409048 3:79813707-79813729 AAAAAGAGATAGAGAGAAGGTGG - Intergenic
957586534 3:82139426-82139448 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
957758409 3:84522763-84522785 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
958023949 3:88028422-88028444 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
958050036 3:88333481-88333503 AAGAGGACACAGAGGTAATGGGG + Intergenic
958439866 3:94143139-94143161 AAGAGGATATAATAGGAGGGTGG + Intergenic
959049384 3:101510482-101510504 AAGAAGAGGTAGAAGGAAGGTGG - Intronic
959102784 3:102032435-102032457 CAAAGGAGATAGAGGTAAGGTGG + Intergenic
959356273 3:105333341-105333363 TAGAGGATGGAGAGGGTAGGTGG + Intergenic
959626315 3:108456119-108456141 AAGAGGAAAGAGAGGGAGGGAGG + Intronic
959970245 3:112400923-112400945 AAGAGAAAATAGAGGGAGGAAGG + Intergenic
960227732 3:115186485-115186507 AAGATGACAAAGGGGGAAGGCGG - Intergenic
960969569 3:123130019-123130041 AAGAGGGTACAGAGAGGAGGGGG - Intronic
961009544 3:123426646-123426668 AAGAGGTTATGGACGGAAGGAGG + Intronic
961128294 3:124441850-124441872 AAGAAAATATGGAAGGAAGGAGG + Intronic
961135945 3:124511437-124511459 AAGAGGATAGAGAGTGAAGGAGG - Intronic
961553898 3:127684802-127684824 AAGAGGAAGAAGAGTGAAGGTGG + Intergenic
961878862 3:130046030-130046052 AAAAGGATAGAAAGGGATGGAGG + Intergenic
962408865 3:135123900-135123922 AAGAGGATAAAGGTGGAAGAAGG - Intronic
962645829 3:137439090-137439112 AAAGGGAAAGAGAGGGAAGGAGG - Intergenic
962842827 3:139251388-139251410 GAGAGGAGAAAGAGGGGAGGAGG - Intronic
963066399 3:141267894-141267916 AAGAAGAGAGAAAGGGAAGGTGG - Intronic
963124533 3:141802918-141802940 AAAAGGAGAGTGAGGGAAGGGGG - Intronic
963187810 3:142438681-142438703 AAGAGGATATCGTGGCCAGGCGG - Intronic
963504824 3:146171106-146171128 AAAAGATTATAGAGGGAGGGAGG - Intergenic
963570295 3:146986341-146986363 AAGAGCAGAGAGAGGAAAGGTGG - Intergenic
963632688 3:147752763-147752785 AAGAGGAAACAGAAGGAAAGGGG + Intergenic
963655895 3:148049698-148049720 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
963673870 3:148284204-148284226 ATGAGGACATAGAGAGAAGATGG - Intergenic
963937746 3:151072289-151072311 AGGAGGAAACAGAGGCAAGGAGG - Intergenic
963956279 3:151257926-151257948 AAGAAGCTAGAGAGGGAAGGTGG - Intronic
964278846 3:155039194-155039216 CAGAGGATATAGGAGCAAGGTGG + Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
965487307 3:169293609-169293631 AAGGGGATAAAGAGTAAAGGGGG - Intronic
966012220 3:175094623-175094645 AAGAAGAGATGGAGGGAGGGAGG + Intronic
966353363 3:179055247-179055269 AAGAGGATATTGTGGCCAGGCGG - Intronic
966592348 3:181696532-181696554 AAGAAGAAAGAGAGGGAGGGAGG - Intergenic
966621568 3:181969708-181969730 AAGAGTAGATAAAGGGAAGTAGG + Intergenic
967609681 3:191489547-191489569 AAGAGGAGAAGGAGGGAATGGGG + Intergenic
967674561 3:192281194-192281216 TAGAGGATTCAGAGGGAAGATGG - Intronic
967734891 3:192941751-192941773 AAGAGGGAAGAGAGGGAGGGAGG - Intergenic
968991082 4:3913078-3913100 AAAAGGATAGAAAGGGATGGAGG + Intergenic
969134571 4:5019777-5019799 AGGAGGACAGAGATGGAAGGAGG + Intergenic
969145862 4:5123609-5123631 TGGAGGACACAGAGGGAAGGTGG - Intronic
969822746 4:9732785-9732807 AGGGGGATGGAGAGGGAAGGTGG + Intergenic
969922956 4:10557850-10557872 AAGAGGAGATAGGGGCACGGGGG + Intronic
970430217 4:15982358-15982380 AACAGAACATAGAGGGAAGGGGG - Intronic
970698333 4:18704634-18704656 AAGAAAAGAAAGAGGGAAGGAGG - Intergenic
971379693 4:26085469-26085491 CAGAGGATGTAAAGGCAAGGAGG - Intergenic
972019401 4:34291122-34291144 AGGAAGAAAGAGAGGGAAGGGGG + Intergenic
972108577 4:35525663-35525685 AAGAGGATGGAGTAGGAAGGTGG + Intergenic
972770055 4:42189410-42189432 AAGAGGATAAGGAGGGATCGCGG - Intergenic
974020434 4:56687951-56687973 AGGTGGATAGAGAGGGAGGGAGG + Intergenic
974029507 4:56763519-56763541 AAGAGGAGAGGGAGGGAGGGAGG - Intergenic
974145558 4:57943226-57943248 AAGAAGATAAAGAAGAAAGGAGG + Intergenic
974146184 4:57950435-57950457 AACAGGAGAAACAGGGAAGGTGG - Intergenic
974174984 4:58310014-58310036 AAGGGGATGTAGTGGGAAGATGG + Intergenic
974471200 4:62320077-62320099 CAGAGGACATAGAGGAAAGAAGG + Intergenic
974473884 4:62355153-62355175 GAGAGGAAATGGAGGGAGGGAGG - Intergenic
974491885 4:62574293-62574315 AAGAAGAAATAGAGGAAAGAAGG + Intergenic
975600431 4:76094076-76094098 ATGAGGATATAGTGAGAAGGTGG + Intronic
976722241 4:88179983-88180005 AAGAGGAGGTAGAGAGAGGGGGG + Intronic
976763837 4:88578824-88578846 AAGATCATATAGTGGGAAAGAGG + Intronic
977045195 4:92060814-92060836 AAGAGGATGCAGTGAGAAGGTGG + Intergenic
977126334 4:93173429-93173451 AAGAAGAAAGAGAGGGAGGGAGG + Intronic
977381503 4:96279903-96279925 AAAAGGATATTGAAGGAGGGAGG - Intergenic
977472233 4:97455567-97455589 AAGGGGATGTAGTGGGAAGGTGG - Intronic
977638587 4:99329535-99329557 GTGAGGATACAGAGGGAAGGTGG + Intergenic
977870325 4:102082895-102082917 AGGAGGAGATGGAGGGAGGGAGG - Intergenic
978398840 4:108310402-108310424 AAGGGGATGAAGTGGGAAGGTGG - Intergenic
978586936 4:110283773-110283795 AAGAGGATATCGTGGCCAGGCGG + Intergenic
978993411 4:115117538-115117560 AAAAGGATATAGACAGAAAGTGG - Intergenic
979418000 4:120466854-120466876 AGGAGGAAAGGGAGGGAAGGAGG + Intergenic
979716489 4:123844716-123844738 AAGGGGATGTAGTGGGAAGGTGG + Intergenic
979919305 4:126478507-126478529 AAGAAGATGGAGTGGGAAGGTGG - Intergenic
980097317 4:128504705-128504727 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
980968752 4:139549584-139549606 AGGAAGAGAAAGAGGGAAGGAGG - Intronic
981619851 4:146682392-146682414 AGGAGGATAAATAGGGAATGGGG + Intergenic
981644507 4:146983622-146983644 AAAAGGATATAGAAGGAAAGAGG + Intergenic
981745908 4:148052230-148052252 AGGAGGAGAGAGAGGGAAGAAGG - Intronic
982118574 4:152117817-152117839 AAGAGGAGCAAGAGAGAAGGGGG + Intergenic
982134474 4:152260152-152260174 AGGAGGATAATGAGGGAAAGAGG - Intergenic
983552533 4:169032293-169032315 AAGAGGAGAGAGAGGGAATAAGG - Intergenic
983678426 4:170323310-170323332 AAGGGGATTTAGGGGGAAGGAGG - Intergenic
983849129 4:172558513-172558535 GTGAGGATACAGAGAGAAGGTGG + Intronic
983927635 4:173418818-173418840 AAGAAGAAAGAGAGTGAAGGGGG - Intergenic
983941088 4:173534759-173534781 AAGAAGAGAGAGAGGGAGGGAGG - Intergenic
983945554 4:173582494-173582516 AAGAGGATACAGAGTTAAGGAGG - Intergenic
983959321 4:173733116-173733138 ATGAGGGTATAAAGGGAAAGGGG - Intergenic
984100703 4:175482049-175482071 ACGAGGACATAGTGGGGAGGAGG - Intergenic
984170422 4:176351768-176351790 AAGAGAAAATAGGGGGAAGAAGG + Intergenic
984233143 4:177124242-177124264 GAGAGGAAAGAGAGGGAGGGAGG - Intergenic
984587282 4:181578718-181578740 AGGAGGATGCAGAGGGGAGGTGG - Intergenic
984993976 4:185409926-185409948 AAGAGCCTATGGAGGGAAGGTGG + Intronic
985055440 4:186031720-186031742 AAGAGGAGAGAGAGGCAATGTGG + Intergenic
985404426 4:189623163-189623185 AAGAGCAAAGAGAGGGAAGAGGG - Intergenic
985999548 5:3619828-3619850 AAGAGGATCTTGAGTGAAGTGGG + Intergenic
986266452 5:6195421-6195443 AACAGGAGAGAGAGTGAAGGGGG - Intergenic
986342755 5:6805264-6805286 AAGAGGACAGAGAAAGAAGGAGG - Intergenic
986556599 5:9016229-9016251 AAGAGGACAGAGAGAGAAGGTGG - Intergenic
986692004 5:10320886-10320908 AGGAGAAGAGAGAGGGAAGGGGG + Intergenic
986796533 5:11218063-11218085 AAGAGGAAAAGGAAGGAAGGAGG - Intronic
987003431 5:13684878-13684900 AAGAAAATATAGAGAGCAGGTGG - Intergenic
987188093 5:15445398-15445420 TAGAGCATTTAGAGAGAAGGTGG + Intergenic
987453761 5:18118906-18118928 AAGAGGAAAAAGAGTGATGGAGG - Intergenic
987760887 5:22161729-22161751 AAGAAGAGAGAGAGGGAGGGGGG + Intronic
988101101 5:26680005-26680027 AAGAGGAGAAAGAGGGAGGGAGG - Intergenic
988845991 5:35128924-35128946 AAGAGGGAATACGGGGAAGGAGG - Intronic
989317732 5:40102393-40102415 AGGGGGATAGAGTGGGAAGGTGG - Intergenic
989481446 5:41935402-41935424 AAAAGGATATAGAAAGCAGGAGG - Intronic
989482151 5:41943939-41943961 ATGAGGACATAGTGAGAAGGTGG + Intergenic
989635108 5:43523608-43523630 AAGGGGCTTTAGAGGGAAAGGGG + Intergenic
990007937 5:50964707-50964729 AAGCGGATACACATGGAAGGGGG - Intergenic
990210296 5:53476499-53476521 AAGAGAATATGGAGGGAGTGGGG - Intergenic
990331271 5:54728304-54728326 AGAAGGATAAGGAGGGAAGGAGG + Intergenic
990624786 5:57598689-57598711 AAGAGGAAGCAGAGGCAAGGAGG - Intergenic
990851477 5:60209747-60209769 AAAAGGAGGGAGAGGGAAGGAGG + Intronic
991089375 5:62679215-62679237 AAAAGGGAAAAGAGGGAAGGGGG + Intergenic
991425729 5:66489749-66489771 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
991432433 5:66562357-66562379 AAGTGGAGACTGAGGGAAGGAGG - Intergenic
991895665 5:71395191-71395213 AAGAAGAGAGAGAGGGAGGGGGG + Intergenic
992375151 5:76181592-76181614 AGCAGGAGAGAGAGGGAAGGGGG + Intronic
992602214 5:78413930-78413952 AAGAGAAGAGGGAGGGAAGGGGG - Intronic
992904614 5:81334095-81334117 AGGAGGATGGAGTGGGAAGGTGG - Intronic
993007925 5:82448237-82448259 AATAGGGCTTAGAGGGAAGGAGG - Intergenic
993036243 5:82760776-82760798 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
993379595 5:87191370-87191392 AAGAGGAAAAGCAGGGAAGGAGG + Intergenic
993414440 5:87609216-87609238 AAGAGCATTTAGGGGGAAAGGGG - Intergenic
994455423 5:100000677-100000699 AAGAGGATAAAGTTTGAAGGAGG + Intergenic
995118230 5:108505975-108505997 AAGAGGAAATAGAGGAGAGGAGG - Intergenic
995121128 5:108536189-108536211 AAGAGGATGGAGCCGGAAGGTGG - Intergenic
995176017 5:109178029-109178051 AAGAGAATAGAGAGAAAAGGAGG + Intronic
995250691 5:109989947-109989969 AAGAGGGTAAAGAGGGTATGTGG - Intergenic
995259356 5:110083809-110083831 ATGAGGAAGAAGAGGGAAGGTGG - Intergenic
995377073 5:111486550-111486572 AAGAGCAAAGAGAGGGAAGGGGG + Exonic
995421896 5:111977141-111977163 AAGAGCATATGGTGGGAGGGAGG + Intronic
995688662 5:114799238-114799260 AAGGAGGAATAGAGGGAAGGAGG + Intergenic
995891186 5:116953704-116953726 AAAGGGATAAAGAAGGAAGGGGG + Intergenic
995941536 5:117591836-117591858 AAGGGGAAAGAGAGGGAAGTGGG - Intergenic
996387534 5:122925091-122925113 AAGGGAAGAGAGAGGGAAGGAGG - Intronic
996506381 5:124272177-124272199 AAGAGAAAATAGAAGAAAGGAGG + Intergenic
996934584 5:128933468-128933490 AAGAGGATAGAGAGGAAGAGAGG - Intronic
997739899 5:136244160-136244182 AGGAAGAAAGAGAGGGAAGGAGG - Intronic
997830877 5:137148561-137148583 AAGAGGAAGTAGAAGGAAAGGGG + Intronic
997961980 5:138329468-138329490 AGGAGGATAGAGACGGAAGGTGG - Intronic
997999766 5:138615694-138615716 AGGAGGATAGAGAGGGAGGCTGG + Intronic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
998870993 5:146551485-146551507 AACTGGATAGAGAGGGAGGGAGG + Intergenic
999858979 5:155624745-155624767 AGGAGGAGAGAGAGAGAAGGAGG + Intergenic
999966563 5:156816517-156816539 AAGAGGTGACAGAAGGAAGGGGG + Intergenic
1000116610 5:158159842-158159864 AAGAGGAGATGGTGGGTAGGAGG - Intergenic
1000137142 5:158363775-158363797 AAGTGGACACAGAGGGATGGTGG + Intergenic
1000169533 5:158688313-158688335 AAGAGGATAAAGATGAGAGGTGG - Intergenic
1000175231 5:158745717-158745739 TAGAGGATAAAGAGGGAGGGTGG + Intronic
1000444180 5:161299637-161299659 AAGAGGAGGAAGAGGGAAAGAGG - Intronic
1000727015 5:164784376-164784398 AAGAAGAGAAAGGGGGAAGGGGG + Intergenic
1000783724 5:165516432-165516454 AACAGGAGAGAGAGTGAAGGGGG + Intergenic
1000827081 5:166058417-166058439 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1001182013 5:169529306-169529328 AAGGGGACAGAGAGGGCAGGAGG - Intergenic
1001582027 5:172805436-172805458 AAGAAGATACGGAGGGAGGGAGG + Intergenic
1001919452 5:175588783-175588805 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1001949752 5:175808021-175808043 AAGAGGAAATAGAGAGCTGGGGG + Intronic
1002850909 6:995645-995667 TTGAGGATGGAGAGGGAAGGAGG - Intergenic
1003063878 6:2885603-2885625 AAGAAGGTAGAGAGGGAGGGAGG - Intergenic
1003066489 6:2908343-2908365 AAGAGGATGTAGAGAGGAGAAGG + Intergenic
1003205160 6:4002353-4002375 GAAAGGAGACAGAGGGAAGGAGG - Intergenic
1003256162 6:4476741-4476763 AAGAAAATTTAGAGGGAAGAAGG - Intergenic
1003561664 6:7185622-7185644 AAGAGGAGTGAGAGGGAAGGTGG + Intronic
1004109420 6:12700903-12700925 AAGAGGATAAAAAGGTAAGCAGG - Intergenic
1004144742 6:13054874-13054896 TTGAGGATGTAGAGGGAAGAAGG - Intronic
1004595355 6:17094349-17094371 GAGAGAAGACAGAGGGAAGGAGG + Intergenic
1005471561 6:26166410-26166432 AAGAAGGAATAAAGGGAAGGAGG - Intronic
1005569793 6:27133655-27133677 AAGAAAAACTAGAGGGAAGGTGG + Exonic
1005773915 6:29108217-29108239 AAGACAATATACAGGGAATGTGG + Intergenic
1006485299 6:34334946-34334968 AAGAGGAAAGAGAGAGAAAGAGG + Intronic
1006731008 6:36236131-36236153 AGGAGGATGGAGTGGGAAGGTGG - Intergenic
1007226131 6:40316120-40316142 TAGAGGAGAGAGAGGGAAAGAGG - Intergenic
1007390168 6:41546310-41546332 AGGAGGGTGGAGAGGGAAGGAGG - Intergenic
1007424469 6:41737731-41737753 CTGAGGATATAGGAGGAAGGTGG + Exonic
1007759796 6:44127290-44127312 AAGAGGAGAAGGAGGGAATGAGG + Intronic
1007962965 6:45977779-45977801 AAGAGGATTTCCAGGGAAGATGG - Intronic
1009394064 6:63177070-63177092 AATGGGATATAGAGGGAGGGAGG - Intergenic
1009544643 6:65007401-65007423 AAGAGGGTATAGTGGCCAGGCGG - Intronic
1010135596 6:72548887-72548909 AGGAGGAGAGAGAGTGAAGGGGG - Intergenic
1010345977 6:74811265-74811287 AAGAAGACAGAGAGGGAGGGAGG + Intergenic
1010415665 6:75608488-75608510 AAGAGGAAAAAGAGGAAAGGAGG + Intronic
1010891421 6:81316277-81316299 ATGAGGACACAGAGAGAAGGTGG + Intergenic
1011113144 6:83860184-83860206 AAGATGAGGTTGAGGGAAGGCGG - Intronic
1011338747 6:86288436-86288458 AAGAAGATATACAAGGAAGATGG - Intergenic
1011429792 6:87273211-87273233 AAGAGGGTATAGTGGGAATAAGG + Intergenic
1011539992 6:88418741-88418763 AAGAGGATATCGTGGCCAGGCGG + Intergenic
1011793443 6:90925881-90925903 CAAAGCATATAGGGGGAAGGAGG - Intergenic
1011940110 6:92832699-92832721 AAGAGAAAATAGGGGGAAGAAGG - Intergenic
1012113486 6:95263513-95263535 AAGGGGATAGAGTGGGAAGGTGG + Intergenic
1012128548 6:95461747-95461769 AAGAGCATATAGGATGAAGGGGG - Intergenic
1012530888 6:100234949-100234971 GAGAAGAAAGAGAGGGAAGGAGG + Intergenic
1013824558 6:114195738-114195760 GAGAGGAGAAAGAGGGAAAGTGG + Intronic
1013981487 6:116134850-116134872 AGGAGGATATAGATGTAAGAGGG + Intronic
1014914364 6:127127810-127127832 ATGAGGATAAAGAAAGAAGGAGG - Intronic
1015129409 6:129792886-129792908 GAGTGGATATATAGGGAATGTGG + Intergenic
1015478415 6:133679580-133679602 AAGAGGGAAGAGAGAGAAGGAGG + Intergenic
1015577806 6:134691180-134691202 AAGAGGAGAAAGAAGGAGGGAGG + Intergenic
1015645251 6:135380035-135380057 AAGAAGAAAGAGAGGGAGGGAGG - Intronic
1015783026 6:136891070-136891092 AAGAGGAGATAAAGGAAAAGAGG - Intronic
1015973549 6:138767042-138767064 GAGAAGAAAGAGAGGGAAGGAGG - Intronic
1016199626 6:141392841-141392863 AAGAGAAGAAAGAGAGAAGGAGG - Intergenic
1016516381 6:144897089-144897111 ATGAGGATATAATGAGAAGGTGG - Intergenic
1018149308 6:160923772-160923794 AAGAGGATACAGTCGGATGGTGG + Intergenic
1018398149 6:163396949-163396971 AAGAGTATTTAGAGGGGAGTTGG + Intergenic
1018463018 6:164017114-164017136 AACAGGAGATACAGGGAGGGAGG - Intergenic
1018577886 6:165278443-165278465 AGCTGGATATAGAGGGAAAGGGG - Intergenic
1018760910 6:166893694-166893716 AAGAGGATATCGTGGCCAGGCGG - Intronic
1018925550 6:168204296-168204318 TAGAGGATACAGGGGGATGGGGG + Intergenic
1019730592 7:2627430-2627452 AAGAGGGGAAAGAAGGAAGGAGG + Intergenic
1019800221 7:3082928-3082950 AAAGGGATTTAGAAGGAAGGGGG - Intergenic
1020180172 7:5916250-5916272 AATAAAATATTGAGGGAAGGGGG - Intronic
1020254162 7:6492766-6492788 AGGAGGATAGAGGAGGAAGGAGG + Intergenic
1020302760 7:6808632-6808654 AATAAAATATTGAGGGAAGGGGG + Intronic
1020458073 7:8396842-8396864 AGAAGGAGATAGAGGGAATGAGG + Intergenic
1020604550 7:10320031-10320053 ATGAGGAAATGGAGGGAGGGAGG - Intergenic
1020677505 7:11198681-11198703 AAGAGGGGAAGGAGGGAAGGAGG - Intergenic
1021141452 7:17030537-17030559 AAGAGGACAGAAAGAGAAGGAGG + Intergenic
1022172535 7:27843685-27843707 AAGAGGCTACAGAGGCCAGGAGG + Intronic
1022289071 7:28983940-28983962 AGGAGGAGAGAGAGGGAGGGTGG + Intergenic
1022568097 7:31423603-31423625 AGGGGGAAATAGTGGGAAGGGGG - Intergenic
1022601881 7:31768620-31768642 GAGAAGCTATAGATGGAAGGCGG - Intronic
1024316191 7:48019227-48019249 AAGAGGAGAGAGAGAGAAAGGGG + Intronic
1025143607 7:56485473-56485495 ATGAGAATATTGAGGGATGGGGG - Intergenic
1025259243 7:57406307-57406329 ATGAGAATATTGAGGGATGGGGG - Intergenic
1026154775 7:67817444-67817466 ATGAGGATACAGAGAGAAGATGG - Intergenic
1026222845 7:68415414-68415436 AAGACGATGGAGAGGGAAGAGGG + Intergenic
1026228476 7:68462986-68463008 AAGAGGAGAGAGAAGGAAAGAGG - Intergenic
1026321123 7:69268412-69268434 GAGAGGATAGAGAGGGACAGAGG - Intergenic
1026503889 7:70965942-70965964 GTGAGGATATAGGGAGAAGGTGG + Intergenic
1026521135 7:71119000-71119022 AAGATGAGATAGACCGAAGGTGG - Intergenic
1026589286 7:71681472-71681494 AAGGGGACATAGAGGGTGGGAGG + Intronic
1026837637 7:73649012-73649034 GAGAGGAGAGAGAGGGAAAGGGG - Intergenic
1026857219 7:73762681-73762703 AGGAAGAGATAGAGGGAGGGAGG - Intergenic
1027708514 7:81567150-81567172 AAGGGGATGGAGTGGGAAGGTGG - Intergenic
1027858457 7:83543669-83543691 AAGATGATATAGATGGAAAGAGG + Intronic
1028460744 7:91089445-91089467 AAGATGAAAAAGAGGGGAGGAGG - Intronic
1028814311 7:95126988-95127010 AAGAGGAAAGAGAGGTAAAGAGG - Intronic
1029584867 7:101463841-101463863 AAGAGAAAAAAGAGGGAGGGAGG - Intronic
1029811620 7:103054811-103054833 AGGAGGAGAAAGAGGAAAGGGGG + Intronic
1029910209 7:104137752-104137774 AGGAGGATGGAGTGGGAAGGTGG - Intronic
1029991122 7:104963419-104963441 AAGAGGAGACAGAGGAAAGCAGG - Intergenic
1030075768 7:105735145-105735167 AAGGGGATCTAGTGGGAAAGTGG - Intronic
1030337165 7:108339915-108339937 AAGAGGATATTGTGGCCAGGAGG - Intronic
1030519113 7:110575374-110575396 TAGAGGAGGTAGATGGAAGGTGG - Intergenic
1030602153 7:111604817-111604839 ATGAGGATACAGAAAGAAGGAGG - Intergenic
1030843622 7:114383657-114383679 AAGAGGATATCGTGGCCAGGCGG + Intronic
1030942453 7:115670977-115670999 AAGAGAAGATAGAGGGACAGGGG + Intergenic
1031049916 7:116934724-116934746 GGGAGGATAGAGAGGGACGGAGG - Intergenic
1031320505 7:120320757-120320779 AATAGGATTTAGAGGAAGGGAGG + Intronic
1031437650 7:121752458-121752480 AAGAACAAAAAGAGGGAAGGGGG + Intergenic
1031484592 7:122311705-122311727 AAGAGGAGACAGTGGGAAGAGGG - Intergenic
1031583346 7:123504576-123504598 AGGAGGAGAAAGAGTGAAGGAGG + Intronic
1031681481 7:124680628-124680650 GAGAGGATAGAGTGGGAAGGGGG - Intergenic
1031695369 7:124845042-124845064 TGGAGGATTTAGAGGAAAGGAGG - Intronic
1032123856 7:129176562-129176584 GAGAGGATAGAGAGTGATGGAGG + Intergenic
1032526526 7:132581956-132581978 AAGGGGAGATGGAGGGAGGGAGG + Intronic
1032625859 7:133590699-133590721 AAGAGGATGCAGTGGAAAGGTGG - Intronic
1033633832 7:143189483-143189505 AAGTGGATAGAGCAGGAAGGGGG + Intergenic
1033665296 7:143435562-143435584 AAGAGGGAAGAGAGAGAAGGAGG - Intergenic
1033784352 7:144712876-144712898 TAAAGGAGAGAGAGGGAAGGAGG + Intronic
1034228634 7:149501778-149501800 AGGAGGATGGAGTGGGAAGGTGG + Intergenic
1034388133 7:150757932-150757954 AAGAGGAGAGAGTGGGAAAGAGG + Intergenic
1034551708 7:151824848-151824870 CAGAAGAAAGAGAGGGAAGGGGG - Intronic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1034903682 7:154924946-154924968 AAGAGGGCATATAAGGAAGGTGG + Intergenic
1036124064 8:6047106-6047128 ACAAGGATACAGTGGGAAGGTGG - Intergenic
1036541461 8:9716663-9716685 AAGAGGGGAAAGAGGGAAGCAGG - Intronic
1036677961 8:10850782-10850804 AAGAGAATATGGAGCGGAGGCGG + Intergenic
1037252866 8:16917937-16917959 AATAGGATAAAGAGAGAATGAGG + Intergenic
1037268395 8:17095734-17095756 AAGGAAATAAAGAGGGAAGGAGG - Intronic
1037574481 8:20188302-20188324 AAGATGAAACAAAGGGAAGGAGG - Intergenic
1037588788 8:20295944-20295966 GAGAGGGGAGAGAGGGAAGGAGG - Intronic
1038067124 8:23974781-23974803 AGGAGGAGAAAGAGGGAGGGAGG + Intergenic
1038482098 8:27908953-27908975 AAAAGGAAATAGAGGGAAAAAGG - Intronic
1038594401 8:28873831-28873853 AGGAAGAGATAGTGGGAAGGGGG - Intronic
1038922504 8:32100123-32100145 GAGAGGAGGCAGAGGGAAGGAGG - Intronic
1039021923 8:33217463-33217485 AAGTGGATAGAGTGGGAAGTTGG - Intergenic
1039412837 8:37369830-37369852 AAGAGGAAATAGAGGGGGTGAGG - Intergenic
1039428576 8:37506776-37506798 AAGAAGGGAGAGAGGGAAGGAGG + Intergenic
1040099733 8:43488184-43488206 AAGAGGAGAAAGAGGGAGGTTGG + Intergenic
1040484839 8:47860219-47860241 AGGAGCATATAGAGGGATAGTGG + Intronic
1040571676 8:48616864-48616886 AAGAGGATTTGGAAGGAAAGAGG + Intergenic
1040795678 8:51288222-51288244 AAGAGGGGAGAAAGGGAAGGGGG - Intergenic
1040828818 8:51654419-51654441 AAGAAGAAATAGGGAGAAGGAGG - Intronic
1041206868 8:55508659-55508681 AAGAGGTTCAAGAGAGAAGGAGG + Intronic
1041231359 8:55756539-55756561 AAGAGGAAAGAGAGGGAAGAAGG - Intronic
1041321922 8:56622294-56622316 AAAAGGAGAAAGGGGGAAGGAGG + Intergenic
1041392409 8:57358778-57358800 GAGAAGAAAGAGAGGGAAGGGGG - Intergenic
1041654438 8:60335062-60335084 CAGAGGATGCAGAGGGAAGGGGG + Intergenic
1041664006 8:60424850-60424872 AAGAGGATATTGTGGCCAGGCGG + Intergenic
1041734906 8:61099629-61099651 AAGACTACATAGAGGGAGGGAGG + Intronic
1041854921 8:62440672-62440694 AAGAAGAAAAAGAAGGAAGGAGG - Intronic
1041970175 8:63731825-63731847 AATAGAATATAGGGGGAAGGAGG + Intergenic
1042648449 8:71013199-71013221 AAGAGTATCTAGAGGAATGGAGG + Intergenic
1042903557 8:73750719-73750741 AAGAGGACATAGAAGGAAACTGG - Intronic
1043285962 8:78531783-78531805 AGGAGGAGAGAGAGGGAAGAAGG + Intronic
1043832550 8:85007150-85007172 AGGAGGAAAGAGTGGGAAGGGGG + Intergenic
1043856327 8:85269501-85269523 AAGAGGAAAGAGAGAGAAAGGGG + Intronic
1043951759 8:86317081-86317103 AAGAGGATATTTGGGAAAGGTGG - Intronic
1043998420 8:86847667-86847689 AAGAGGAAAGGGAGGGAGGGAGG + Intergenic
1044693109 8:94897425-94897447 AAGAGAAAATAAAGGGTAGGGGG + Intronic
1044953164 8:97452956-97452978 AGGAAGGGATAGAGGGAAGGAGG + Intergenic
1045035010 8:98170068-98170090 GAGACTTTATAGAGGGAAGGAGG + Intergenic
1045633293 8:104153253-104153275 GAGAGCATATAGAGGGAATAAGG + Intronic
1045735551 8:105292532-105292554 AAGTGGATAAAGAAGGAAAGTGG + Intronic
1046592216 8:116220461-116220483 AAGAAGGGAAAGAGGGAAGGAGG - Intergenic
1046714346 8:117550895-117550917 AAGAGGAGAGAAAGGGAGGGAGG + Intergenic
1046754258 8:117956832-117956854 AAGAGGAGAGAGAAAGAAGGAGG + Intronic
1047005959 8:120620914-120620936 AAGAAGAGAGAGAGGGAGGGAGG - Intronic
1047254833 8:123207125-123207147 AAGAGGAGAGAGAGTGATGGAGG - Intronic
1047444011 8:124903499-124903521 AAGAGGATATTGTGGCCAGGCGG + Intergenic
1047518668 8:125577712-125577734 AAGAAGAGACAGAGGGAGGGAGG - Intergenic
1047536831 8:125727580-125727602 AAGAGAATAGAGAGGGAAGTGGG + Intergenic
1047846227 8:128808394-128808416 AAGAGAGAATAAAGGGAAGGAGG - Intergenic
1048313445 8:133344262-133344284 AAGGGGAGAGAGAAGGAAGGAGG - Intergenic
1048519672 8:135141947-135141969 AAAGGGAGAGAGAGGGAAGGAGG + Intergenic
1048591600 8:135825718-135825740 AAATGGATAAAGAGGGAAAGAGG - Intergenic
1048748983 8:137649606-137649628 AAGAGGAGATGGAAAGAAGGAGG + Intergenic
1049702275 8:144020687-144020709 AAGAGGATCCTGAGGGAAGAGGG - Intronic
1049702858 8:144022998-144023020 AAGAGGGTCTTGAGGGAAGAGGG - Intronic
1049703150 8:144024051-144024073 AAGAGGGTCCTGAGGGAAGGTGG - Intronic
1049703397 8:144024927-144024949 AAGAGGATCTTGAAGGAAGAGGG - Intronic
1050414152 9:5397624-5397646 AAGAGGGGAGAGAGGGAAGAAGG + Intronic
1050515805 9:6442853-6442875 AAGAGGATAAAGAGAACAGGTGG - Intronic
1050641891 9:7677262-7677284 CAGATGATATAGAGGTAGGGAGG + Intergenic
1050664953 9:7925459-7925481 AAGAAGGAAGAGAGGGAAGGAGG + Intergenic
1050748069 9:8901023-8901045 AAGGGGATATAGAAAAAAGGAGG + Intronic
1050978865 9:11981300-11981322 AAGAGAATATTGAGTGAAGGAGG - Intergenic
1051160555 9:14203108-14203130 AAGAGGATATTAATAGAAGGAGG - Intronic
1051524158 9:18024019-18024041 AAGAAGAAAGGGAGGGAAGGGGG - Intergenic
1051692427 9:19729703-19729725 AAGAGGCTGGATAGGGAAGGAGG + Intronic
1051693354 9:19741285-19741307 AAGGGGAGCTAGAGGGAAGTGGG + Intronic
1051904011 9:22074428-22074450 AAGAGGACATAGGGGGATGTAGG + Intergenic
1052298346 9:26924495-26924517 AAGAGGAAATAAAGGGTTGGAGG - Intronic
1052324618 9:27204386-27204408 AAGAAGAGAGAGAGGGAGGGAGG - Intronic
1052400300 9:27991573-27991595 AAAAGGATATAGACAGAAAGAGG + Intronic
1052438718 9:28465300-28465322 AAGGGGATAAAGTGGGAAGGCGG + Intronic
1053595019 9:39551809-39551831 AAGAGGAAAGAGGGGGGAGGGGG - Intergenic
1053852801 9:42306837-42306859 AAGAGGAAAGAGGGGGGAGGGGG - Intergenic
1054571233 9:66813164-66813186 AAGAGGAAAGAGTGGGGAGGGGG + Intergenic
1055054379 9:72010561-72010583 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
1055618061 9:78093826-78093848 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1055729844 9:79269174-79269196 AAGAACATATCGAAGGAAGGAGG + Intergenic
1055914718 9:81389361-81389383 AAGAAGAGATAGAGAAAAGGGGG + Intergenic
1056139606 9:83663102-83663124 AAGAGGAAAAAGGGGAAAGGGGG + Intronic
1056179568 9:84069036-84069058 ATAAGGATATAGCGAGAAGGAGG - Intergenic
1056217097 9:84415627-84415649 AAAAAGAGATAGAGGGAAGGAGG - Intergenic
1056241751 9:84654741-84654763 AAGAGGAAACAGAAGGCAGGAGG + Intergenic
1056327350 9:85490902-85490924 AGGAGGATGGAGTGGGAAGGTGG - Intergenic
1056501319 9:87212611-87212633 AAGAAAATATACAGGGAAGGTGG - Intergenic
1056860422 9:90175725-90175747 AAGAGAATAGAGCGGGAAGGTGG - Intergenic
1057094752 9:92295589-92295611 AAGAGGAGAAAAAGGGAAGAGGG + Intergenic
1057343373 9:94224356-94224378 ACGAGGGGAAAGAGGGAAGGAGG - Intergenic
1057581486 9:96291144-96291166 AAGAGGACAAAGAGGGGAAGAGG - Intronic
1057771603 9:97972961-97972983 AAGAAGAGAAAGAGGGAGGGAGG + Intergenic
1058318454 9:103599183-103599205 AAGGGGATGAAGGGGGAAGGTGG - Intergenic
1058622420 9:106897795-106897817 AGGAGAATAGAGAGGGAAAGAGG + Intronic
1058692613 9:107532273-107532295 AAGAGTACATAGAGGGGAGGTGG - Intergenic
1059036156 9:110755781-110755803 AAGAGGATTTACAAGGAAGGCGG + Intronic
1059283633 9:113154759-113154781 AAGAGGATAGGGTGGGAGGGAGG - Intronic
1059304978 9:113346945-113346967 AAGAGGTTGTGGAGGGCAGGGGG - Intergenic
1059355560 9:113696852-113696874 AAGGAGAAATAGAGAGAAGGGGG - Intergenic
1059370422 9:113826902-113826924 AAAGGGACATAGAGGGAAGTAGG + Intergenic
1059684763 9:116624491-116624513 ATGAGAATACAGAAGGAAGGGGG + Intronic
1059807803 9:117822833-117822855 AAGAGGTTAGAGAGTGAAGAGGG - Intergenic
1060145386 9:121248365-121248387 AAGATGAAAGAGAGGGAGGGAGG - Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1061142314 9:128775038-128775060 AAGAAGAGAGAGAGGGAAGGAGG + Intergenic
1061157905 9:128876090-128876112 AAGAGTAAAGGGAGGGAAGGTGG - Intronic
1061281933 9:129602549-129602571 AAGAGAAGAAAGCGGGAAGGAGG + Intergenic
1061921844 9:133786914-133786936 AAGGGGAGAAAGAGGGAGGGAGG + Intronic
1062569103 9:137176315-137176337 AAGAGGGTTCAGAGGGAACGGGG + Intronic
1062722450 9:138051472-138051494 AAGGGGAGAGGGAGGGAAGGAGG - Intronic
1185504945 X:625090-625112 AAGAAGAAAGAAAGGGAAGGAGG - Intronic
1185545416 X:939947-939969 GAGAGGAGATAGAGGGAGAGAGG - Intergenic
1185545690 X:942012-942034 GAGAGGATAGAGCGAGAAGGCGG - Intergenic
1185545757 X:942718-942740 GAGAGGAGATAGAGGGAGAGAGG + Intergenic
1185545792 X:943085-943107 GAGAGGAGATAGAGGGAGAGAGG + Intergenic
1185999178 X:4989169-4989191 TAGAGGATAGGAAGGGAAGGAGG - Intergenic
1186235303 X:7501735-7501757 AGGAGGAAAAAGTGGGAAGGGGG + Intergenic
1186286235 X:8046731-8046753 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
1186490751 X:9970337-9970359 AAGAAGAGAAAGAGGGAAGAAGG - Intergenic
1187020363 X:15375204-15375226 AAAAGGAGATGGAGGCAAGGTGG - Intronic
1187370883 X:18705103-18705125 AAAAGAAGAGAGAGGGAAGGAGG - Intronic
1187413269 X:19069744-19069766 AAGGGGATGGAGTGGGAAGGTGG - Intronic
1187668778 X:21647059-21647081 TAGAGGATTTTGAGGGATGGGGG - Intronic
1187731287 X:22257766-22257788 AAGAAGAGAGAGAGGGAAGGAGG - Intergenic
1188528257 X:31109059-31109081 ATGAGCATATAAATGGAAGGAGG + Intronic
1188734585 X:33696728-33696750 AAGGGGAGAGAGAGGGAAGAGGG + Intergenic
1188901750 X:35741276-35741298 AAGGAGAGATAGAGGGAAGGAGG + Intergenic
1189222102 X:39381345-39381367 AGGTAGATAGAGAGGGAAGGAGG - Intergenic
1190047538 X:47124738-47124760 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic
1190641771 X:52487121-52487143 ATGAGAATATTGAGGGATGGGGG + Intergenic
1190645901 X:52525744-52525766 ATGAGAATATTGAGGGATGGGGG - Intergenic
1190766663 X:53480945-53480967 AGGGGGATACAGTGGGAAGGTGG - Intergenic
1191109634 X:56794531-56794553 AGAAGAATCTAGAGGGAAGGGGG - Intergenic
1192390937 X:70727785-70727807 ATGAAGATATAGAAAGAAGGTGG + Intronic
1192419849 X:71020008-71020030 AAGAGGTTATTGAGGTAAGATGG - Intergenic
1192498163 X:71630185-71630207 AAAAGGATAGAGAGGGATGCAGG - Intergenic
1192656061 X:72996238-72996260 AAGAGGATATAGAAAGAGGGAGG + Intergenic
1192666059 X:73086763-73086785 AAGAGGATATAGAAAGAGGGAGG - Intergenic
1192892906 X:75408939-75408961 AAGAGGATATAAAGGAAAAATGG + Intronic
1193061959 X:77216201-77216223 GTGAGGATATAGAGAAAAGGTGG - Intergenic
1193269737 X:79515291-79515313 GAGAGGACAGAGAAGGAAGGAGG - Intergenic
1193283411 X:79683321-79683343 TAGAGGAGCTAGTGGGAAGGTGG - Intergenic
1193704078 X:84799260-84799282 AATACGATATAGAGGAAATGAGG - Intergenic
1193853780 X:86573136-86573158 AGGAGGAAAGAGAGGGAGGGAGG + Intronic
1194532677 X:95070455-95070477 AAGAGGAAATAAAGAGATGGGGG + Intergenic
1194591727 X:95807202-95807224 AAGAGGATATAGAGGAGATAGGG + Intergenic
1194599169 X:95899414-95899436 GTGAGGATACAGAGAGAAGGTGG - Intergenic
1195164294 X:102203064-102203086 AGGAAGAGAGAGAGGGAAGGGGG - Intergenic
1195194566 X:102484031-102484053 AGGAAGAGAGAGAGGGAAGGGGG + Intergenic
1195260770 X:103129580-103129602 AAGAAGAGAGTGAGGGAAGGGGG - Intergenic
1195487091 X:105421608-105421630 AAGAGAAAATAGGGGGAAGAGGG + Intronic
1195970019 X:110462884-110462906 AAGAGGGAAGAGAGGGAAAGTGG + Intergenic
1195977793 X:110546454-110546476 AAGAGGACACAGAAAGAAGGTGG + Intergenic
1196115897 X:111999269-111999291 AAGAGGCTAGAAAGGGCAGGGGG - Intronic
1196144982 X:112306633-112306655 AAGAGGGGAAAGATGGAAGGAGG + Intergenic
1196376630 X:115040106-115040128 AGGAGGATGTAGTGGGAAGGTGG - Intergenic
1196754076 X:119142796-119142818 AAGAGGAAAGAGAGGGGAGGAGG + Intronic
1196834543 X:119802181-119802203 AAGAGGAAAGAAAGGGAGGGAGG - Intergenic
1196991457 X:121333643-121333665 CATAGAATTTAGAGGGAAGGAGG + Intergenic
1196998209 X:121407481-121407503 AGGGGGATAGAGTGGGAAGGTGG - Intergenic
1197391765 X:125876519-125876541 AAGAGGATATAGAGAAACAGGGG - Intergenic
1197727470 X:129785946-129785968 AGGAGGAAATAAATGGAAGGTGG + Intronic
1197979902 X:132206185-132206207 AAGAGAAGAAAGAGGGAGGGAGG + Intronic
1198028167 X:132729321-132729343 AAGAGGGGATACAGTGAAGGGGG + Intronic
1199134923 X:144237857-144237879 AAGAAGAGAGAGAGGGAGGGAGG + Intergenic
1199412730 X:147543375-147543397 CAGAGGATATAGTGGGGAGTGGG + Intergenic
1199598867 X:149528687-149528709 AAGAGGGTAGAGAGAGAGGGAGG - Intronic
1199637531 X:149827236-149827258 GAGAGGAAAGAGAGGGAGGGGGG + Intergenic
1199926350 X:152469287-152469309 CAGAGGCTACAGAGTGAAGGGGG + Intergenic
1201339827 Y:12922739-12922761 AAGGGGATGGAGTGGGAAGGTGG + Intergenic
1201349663 Y:13025825-13025847 AAGAAGGAAAAGAGGGAAGGAGG - Intergenic
1201711773 Y:17000540-17000562 GGAAGGAGATAGAGGGAAGGAGG - Intergenic
1201741072 Y:17325299-17325321 AAGAAGAAAGAGAGGGAGGGAGG + Intergenic