ID: 1159105127

View in Genome Browser
Species Human (GRCh38)
Location 18:63995991-63996013
Sequence GTTGCGTAGGCCATCATGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 54}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159105127 Original CRISPR GTTGCGTAGGCCATCATGAT GGG Intronic
902798190 1:18813193-18813215 CTGGCGTGGGCCATCATGATTGG - Intergenic
914234591 1:145797100-145797122 GTCACTTAGGCAATCATGATGGG - Intronic
915756103 1:158261519-158261541 GTTGCTTAAGCAATCATGATGGG + Intergenic
918024980 1:180734436-180734458 GTGGGTTAGGCAATCATGATGGG + Intronic
919280899 1:195486577-195486599 GTTGCTTAGACCCTCATGATGGG + Intergenic
921000192 1:211036228-211036250 GTTGGTTAGGCAATCATGATGGG + Intronic
1065424669 10:25587119-25587141 GTTGGTTAGGCAATCATGATGGG + Intronic
1068096997 10:52503936-52503958 GTTGGTTAGACAATCATGATGGG + Intergenic
1069088995 10:64176546-64176568 GTTGGTTAGGCAATCATCATGGG + Intergenic
1079641215 11:22807840-22807862 GTCCCTTAGGCAATCATGATGGG + Intronic
1081131292 11:39383402-39383424 ATTGGTTAGGCAATCATGATGGG + Intergenic
1094598491 12:31887426-31887448 GTTGCTTAGGCAATCATGATGGG - Intergenic
1099467990 12:83010405-83010427 GCTGCTCAGGCAATCATGATGGG - Intronic
1106095260 13:26637790-26637812 GTTGAGGATGCCATCCTGATAGG - Intronic
1106626479 13:31425689-31425711 GTTGCTCAGGCCAACATGCTTGG - Intergenic
1109198550 13:59406175-59406197 GTTGGTTAGGCAATCATGATGGG + Intergenic
1111201600 13:84945088-84945110 GTCGTTTAGGCAATCATGATGGG + Intergenic
1111207043 13:85024502-85024524 GTTGGCTAAGCAATCATGATAGG + Intergenic
1113926014 13:113942086-113942108 GTTGCTCATGCCACCATGATCGG - Intergenic
1125769110 15:42153381-42153403 ATTGTAGAGGCCATCATGATGGG - Intronic
1127528033 15:59813391-59813413 GATGCCCAGGACATCATGATAGG + Intergenic
1131738660 15:95362344-95362366 GTTGGGTAGGCAGTCATGATAGG - Intergenic
1150544345 17:66138267-66138289 GTTGGTCAGGCAATCATGATAGG + Intronic
1154230862 18:12554998-12555020 GTCGGTTAGGCAATCATGATGGG - Intronic
1157969237 18:52247288-52247310 GTTGGTTAGGCAATCATGATAGG + Intergenic
1159105127 18:63995991-63996013 GTTGCGTAGGCCATCATGATGGG + Intronic
1159198453 18:65149716-65149738 GTTGCTTAGGCCGTTATCATGGG + Intergenic
1159363679 18:67437822-67437844 GGCGCTTTGGCCATCATGATGGG + Intergenic
1160295512 18:77633392-77633414 GTTCTGCAGGCCATCCTGATGGG - Intergenic
1167435606 19:49476780-49476802 GTTTCCTAGGCCATGATGAAGGG + Intronic
928697951 2:33869438-33869460 GTTAGATAGGCAATCATGATGGG + Intergenic
929910063 2:46082250-46082272 GTTGCTTGGGCCATAATGGTGGG + Intronic
930508965 2:52320772-52320794 GTTTCTAATGCCATCATGATAGG + Intergenic
931152724 2:59592855-59592877 GTTGCTTAGGCAATCATGATGGG - Intergenic
932649264 2:73537861-73537883 CAAGCGTAGGCCATCATGCTTGG - Intronic
935865220 2:107380740-107380762 GTTGGTTAGGCAATCATGAGGGG - Intergenic
940035147 2:149304943-149304965 CTAGTGTATGCCATCATGATCGG - Intergenic
943257947 2:185620457-185620479 GTTGAATAGGCAATCATGATGGG - Intergenic
943443991 2:187960001-187960023 GTTGCTTAGGCAATCATTATGGG + Intergenic
1169337887 20:4772139-4772161 GTTGCTTAGACAATCATGATGGG - Intergenic
950254630 3:11494294-11494316 GTCACTTAGGCAATCATGATGGG + Intronic
957521871 3:81329079-81329101 ATTACCTAGGCCATCATGACAGG + Intergenic
961312950 3:126015437-126015459 GTTGGGTAGGCCCACAGGATTGG - Intronic
964292812 3:155200110-155200132 GTTGTTTAGGCCACCATGTTTGG + Intergenic
972648943 4:40997063-40997085 GTTGGATAGGCAATCATGATAGG - Intronic
974352334 4:60765258-60765280 GTAGCATCGGGCATCATGATGGG - Intergenic
974534552 4:63157124-63157146 GTCACTTAGGCAATCATGATGGG + Intergenic
986481486 5:8192992-8193014 GTTGGTTAGGCAACCATGATGGG + Intergenic
992468328 5:77029415-77029437 GCTGGTTAGGCAATCATGATGGG + Intronic
999761324 5:154703352-154703374 GTAGCTCAGGCCTTCATGATTGG + Intergenic
1004730502 6:18353617-18353639 ATTGCTTTGGCCATCTTGATAGG - Intergenic
1010989884 6:82468893-82468915 GTTGGTTAGGCAGTCATGATGGG - Intergenic
1012233632 6:96788092-96788114 GTTGGTTAGGCAATCATGACAGG - Intergenic
1014465866 6:121756055-121756077 GTTGGGTAGGCCTTCATTTTAGG + Intergenic
1031253543 7:119418160-119418182 GTCACTTAGGCAATCATGATGGG - Intergenic
1034180177 7:149130956-149130978 GTGGGTTAGGCAATCATGATGGG + Intronic
1039831295 8:41217133-41217155 GTTGCTAAGGGCATCAGGATTGG + Intergenic
1041870990 8:62634276-62634298 GTCGCTTAGGCACTCATGATGGG - Intronic
1042971096 8:74409758-74409780 GTTGCTTAGGCAATCATGATAGG - Intronic
1043060345 8:75492531-75492553 GTGGTGAAGGCCATCATTATTGG - Intronic
1047528245 8:125652246-125652268 GTTGGGGAGGCCTGCATGATGGG + Intergenic
1047671303 8:127149981-127150003 GTTGGTTACGCAATCATGATGGG + Intergenic
1052561732 9:30091952-30091974 GTTGGTTAGGCAATCATGATGGG - Intergenic
1054778540 9:69144906-69144928 ATTGAGTGGGCCACCATGATAGG + Intronic
1054969458 9:71068495-71068517 GTTGTGTAGGACATCATGTTTGG - Intronic
1189077936 X:37937618-37937640 GTTGTGTAGGCCATAATTCTGGG - Intronic
1197179357 X:123517675-123517697 GTTGGTTAGGCAATAATGATGGG + Intergenic
1199948822 X:152689151-152689173 AGAGCGTAGGCCCTCATGATTGG + Intergenic
1199960854 X:152779299-152779321 AGAGCGTAGGCCCTCATGATTGG - Intergenic
1202268384 Y:23044758-23044780 GTTGCCTGGGCCTTCACGATAGG + Intergenic
1202421376 Y:24678502-24678524 GTTGCCTGGGCCTTCACGATAGG + Intergenic
1202449410 Y:24991580-24991602 GTTGCCTGGGCCTTCACGATAGG - Intergenic