ID: 1159108469

View in Genome Browser
Species Human (GRCh38)
Location 18:64029285-64029307
Sequence ATTTGCATGTAATTATAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159108469_1159108476 10 Left 1159108469 18:64029285-64029307 CCCTCTTATAATTACATGCAAAT No data
Right 1159108476 18:64029318-64029340 GTTAATGCAAATTGAGGAGTGGG No data
1159108469_1159108474 4 Left 1159108469 18:64029285-64029307 CCCTCTTATAATTACATGCAAAT No data
Right 1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG No data
1159108469_1159108477 28 Left 1159108469 18:64029285-64029307 CCCTCTTATAATTACATGCAAAT No data
Right 1159108477 18:64029336-64029358 GTGGGTTATGTAGAACTTTCAGG No data
1159108469_1159108475 9 Left 1159108469 18:64029285-64029307 CCCTCTTATAATTACATGCAAAT No data
Right 1159108475 18:64029317-64029339 GGTTAATGCAAATTGAGGAGTGG No data
1159108469_1159108478 29 Left 1159108469 18:64029285-64029307 CCCTCTTATAATTACATGCAAAT No data
Right 1159108478 18:64029337-64029359 TGGGTTATGTAGAACTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159108469 Original CRISPR ATTTGCATGTAATTATAAGA GGG (reversed) Intergenic
No off target data available for this crispr