ID: 1159108478

View in Genome Browser
Species Human (GRCh38)
Location 18:64029337-64029359
Sequence TGGGTTATGTAGAACTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159108470_1159108478 28 Left 1159108470 18:64029286-64029308 CCTCTTATAATTACATGCAAATT No data
Right 1159108478 18:64029337-64029359 TGGGTTATGTAGAACTTTCAGGG No data
1159108469_1159108478 29 Left 1159108469 18:64029285-64029307 CCCTCTTATAATTACATGCAAAT No data
Right 1159108478 18:64029337-64029359 TGGGTTATGTAGAACTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159108478 Original CRISPR TGGGTTATGTAGAACTTTCA GGG Intergenic
No off target data available for this crispr