ID: 1159110759

View in Genome Browser
Species Human (GRCh38)
Location 18:64053949-64053971
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159110759_1159110765 28 Left 1159110759 18:64053949-64053971 CCTCCAAGCAGGAGGAAAGCAAT No data
Right 1159110765 18:64054000-64054022 ACACTGGAAGGTAACCACATAGG No data
1159110759_1159110763 12 Left 1159110759 18:64053949-64053971 CCTCCAAGCAGGAGGAAAGCAAT No data
Right 1159110763 18:64053984-64054006 CTGGACTTACATGAAGACACTGG No data
1159110759_1159110762 -7 Left 1159110759 18:64053949-64053971 CCTCCAAGCAGGAGGAAAGCAAT No data
Right 1159110762 18:64053965-64053987 AAGCAATACTAAATGGAATCTGG No data
1159110759_1159110764 16 Left 1159110759 18:64053949-64053971 CCTCCAAGCAGGAGGAAAGCAAT No data
Right 1159110764 18:64053988-64054010 ACTTACATGAAGACACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159110759 Original CRISPR ATTGCTTTCCTCCTGCTTGG AGG (reversed) Intergenic
No off target data available for this crispr