ID: 1159110764

View in Genome Browser
Species Human (GRCh38)
Location 18:64053988-64054010
Sequence ACTTACATGAAGACACTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159110759_1159110764 16 Left 1159110759 18:64053949-64053971 CCTCCAAGCAGGAGGAAAGCAAT No data
Right 1159110764 18:64053988-64054010 ACTTACATGAAGACACTGGAAGG No data
1159110760_1159110764 13 Left 1159110760 18:64053952-64053974 CCAAGCAGGAGGAAAGCAATACT No data
Right 1159110764 18:64053988-64054010 ACTTACATGAAGACACTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159110764 Original CRISPR ACTTACATGAAGACACTGGA AGG Intergenic
No off target data available for this crispr