ID: 1159115355

View in Genome Browser
Species Human (GRCh38)
Location 18:64107206-64107228
Sequence AGGTTAGTCACTTCTAATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159115355_1159115360 3 Left 1159115355 18:64107206-64107228 CCTGGATTAGAAGTGACTAACCT No data
Right 1159115360 18:64107232-64107254 CTGTTCTGGGCTCATATTCTGGG No data
1159115355_1159115357 -10 Left 1159115355 18:64107206-64107228 CCTGGATTAGAAGTGACTAACCT No data
Right 1159115357 18:64107219-64107241 TGACTAACCTCGACTGTTCTGGG No data
1159115355_1159115359 2 Left 1159115355 18:64107206-64107228 CCTGGATTAGAAGTGACTAACCT No data
Right 1159115359 18:64107231-64107253 ACTGTTCTGGGCTCATATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159115355 Original CRISPR AGGTTAGTCACTTCTAATCC AGG (reversed) Intergenic
No off target data available for this crispr