ID: 1159118051

View in Genome Browser
Species Human (GRCh38)
Location 18:64137376-64137398
Sequence GCACTTTGTTAGGACAACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159118045_1159118051 28 Left 1159118045 18:64137325-64137347 CCAGAACTGTGAGAGAACACATT 0: 5
1: 137
2: 848
3: 2522
4: 4679
Right 1159118051 18:64137376-64137398 GCACTTTGTTAGGACAACCCTGG No data
1159118047_1159118051 -9 Left 1159118047 18:64137362-64137384 CCGCCCAGTTTGTGGCACTTTGT 0: 23
1: 251
2: 990
3: 2510
4: 4459
Right 1159118051 18:64137376-64137398 GCACTTTGTTAGGACAACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159118051 Original CRISPR GCACTTTGTTAGGACAACCC TGG Intergenic
No off target data available for this crispr