ID: 1159120041

View in Genome Browser
Species Human (GRCh38)
Location 18:64158298-64158320
Sequence GCGTGGCATGCCCTGTGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159120036_1159120041 -8 Left 1159120036 18:64158283-64158305 CCCCCCACAGGCACTGCGTGGCA No data
Right 1159120041 18:64158298-64158320 GCGTGGCATGCCCTGTGTCTAGG No data
1159120037_1159120041 -9 Left 1159120037 18:64158284-64158306 CCCCCACAGGCACTGCGTGGCAT No data
Right 1159120041 18:64158298-64158320 GCGTGGCATGCCCTGTGTCTAGG No data
1159120038_1159120041 -10 Left 1159120038 18:64158285-64158307 CCCCACAGGCACTGCGTGGCATG No data
Right 1159120041 18:64158298-64158320 GCGTGGCATGCCCTGTGTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159120041 Original CRISPR GCGTGGCATGCCCTGTGTCT AGG Intergenic
No off target data available for this crispr