ID: 1159131161

View in Genome Browser
Species Human (GRCh38)
Location 18:64281592-64281614
Sequence AGAGGTTTGCTGCAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159131157_1159131161 -8 Left 1159131157 18:64281577-64281599 CCTGGATGTCTAGGCAGAGGTTT No data
Right 1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG No data
1159131152_1159131161 20 Left 1159131152 18:64281549-64281571 CCTAGATTTCAGAGGATGTATGG 0: 1181
1: 2198
2: 1831
3: 1022
4: 603
Right 1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG No data
1159131151_1159131161 26 Left 1159131151 18:64281543-64281565 CCTCTGCCTAGATTTCAGAGGAT 0: 701
1: 1268
2: 1602
3: 1586
4: 1189
Right 1159131161 18:64281592-64281614 AGAGGTTTGCTGCAGGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159131161 Original CRISPR AGAGGTTTGCTGCAGGTGGG AGG Intergenic
No off target data available for this crispr