ID: 1159133072

View in Genome Browser
Species Human (GRCh38)
Location 18:64303392-64303414
Sequence TAAAGCACTTAGAGTGTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159133072_1159133074 10 Left 1159133072 18:64303392-64303414 CCAAGAACACTCTAAGTGCTTTA No data
Right 1159133074 18:64303425-64303447 CCTCAGCAATACAGTGAGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159133072 Original CRISPR TAAAGCACTTAGAGTGTTCT TGG (reversed) Intergenic
No off target data available for this crispr