ID: 1159135174

View in Genome Browser
Species Human (GRCh38)
Location 18:64329094-64329116
Sequence TAGAAGCCCCAATTAGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159135174_1159135177 -4 Left 1159135174 18:64329094-64329116 CCATCCTCTAATTGGGGCTTCTA No data
Right 1159135177 18:64329113-64329135 TCTATAAACACAACACTGGAAGG No data
1159135174_1159135176 -8 Left 1159135174 18:64329094-64329116 CCATCCTCTAATTGGGGCTTCTA No data
Right 1159135176 18:64329109-64329131 GGCTTCTATAAACACAACACTGG No data
1159135174_1159135179 24 Left 1159135174 18:64329094-64329116 CCATCCTCTAATTGGGGCTTCTA No data
Right 1159135179 18:64329141-64329163 TGTAAGATAATATTAGATTAGGG No data
1159135174_1159135178 23 Left 1159135174 18:64329094-64329116 CCATCCTCTAATTGGGGCTTCTA No data
Right 1159135178 18:64329140-64329162 ATGTAAGATAATATTAGATTAGG No data
1159135174_1159135180 25 Left 1159135174 18:64329094-64329116 CCATCCTCTAATTGGGGCTTCTA No data
Right 1159135180 18:64329142-64329164 GTAAGATAATATTAGATTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159135174 Original CRISPR TAGAAGCCCCAATTAGAGGA TGG (reversed) Intergenic
No off target data available for this crispr