ID: 1159137434

View in Genome Browser
Species Human (GRCh38)
Location 18:64352620-64352642
Sequence ACTGTGCCTATTTTATGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159137428_1159137434 1 Left 1159137428 18:64352596-64352618 CCCTAAAGAATGCCACTTTTCCC No data
Right 1159137434 18:64352620-64352642 ACTGTGCCTATTTTATGAGGTGG No data
1159137427_1159137434 9 Left 1159137427 18:64352588-64352610 CCTAAAAACCCTAAAGAATGCCA No data
Right 1159137434 18:64352620-64352642 ACTGTGCCTATTTTATGAGGTGG No data
1159137429_1159137434 0 Left 1159137429 18:64352597-64352619 CCTAAAGAATGCCACTTTTCCCT No data
Right 1159137434 18:64352620-64352642 ACTGTGCCTATTTTATGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159137434 Original CRISPR ACTGTGCCTATTTTATGAGG TGG Intergenic
No off target data available for this crispr