ID: 1159142586

View in Genome Browser
Species Human (GRCh38)
Location 18:64415451-64415473
Sequence TGTCCATAGATGAAAGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159142584_1159142586 6 Left 1159142584 18:64415422-64415444 CCATTGGGACTCTTAGGCAATCT No data
Right 1159142586 18:64415451-64415473 TGTCCATAGATGAAAGTTGGTGG No data
1159142582_1159142586 16 Left 1159142582 18:64415412-64415434 CCAGCTAAGTCCATTGGGACTCT No data
Right 1159142586 18:64415451-64415473 TGTCCATAGATGAAAGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159142586 Original CRISPR TGTCCATAGATGAAAGTTGG TGG Intergenic
No off target data available for this crispr