ID: 1159152205

View in Genome Browser
Species Human (GRCh38)
Location 18:64535031-64535053
Sequence GACAGCTCTTGGCATGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159152205_1159152208 11 Left 1159152205 18:64535031-64535053 CCAGTAACATGCCAAGAGCTGTC No data
Right 1159152208 18:64535065-64535087 GAGTATCTCTCTGTGGAAGATGG No data
1159152205_1159152207 4 Left 1159152205 18:64535031-64535053 CCAGTAACATGCCAAGAGCTGTC No data
Right 1159152207 18:64535058-64535080 AAAAGAAGAGTATCTCTCTGTGG No data
1159152205_1159152210 15 Left 1159152205 18:64535031-64535053 CCAGTAACATGCCAAGAGCTGTC No data
Right 1159152210 18:64535069-64535091 ATCTCTCTGTGGAAGATGGAGGG No data
1159152205_1159152209 14 Left 1159152205 18:64535031-64535053 CCAGTAACATGCCAAGAGCTGTC No data
Right 1159152209 18:64535068-64535090 TATCTCTCTGTGGAAGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159152205 Original CRISPR GACAGCTCTTGGCATGTTAC TGG (reversed) Intergenic
No off target data available for this crispr