ID: 1159152579

View in Genome Browser
Species Human (GRCh38)
Location 18:64538811-64538833
Sequence CAGGCAGCAAGGTGGGACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159152565_1159152579 30 Left 1159152565 18:64538758-64538780 CCTGCATTGCCTTTCCTCTTCTC No data
Right 1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG No data
1159152566_1159152579 21 Left 1159152566 18:64538767-64538789 CCTTTCCTCTTCTCTCTTTTGTT No data
Right 1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG No data
1159152571_1159152579 -4 Left 1159152571 18:64538792-64538814 CCTTTGTTCAGGGCATTGCCAGG No data
Right 1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG No data
1159152568_1159152579 16 Left 1159152568 18:64538772-64538794 CCTCTTCTCTCTTTTGTTGGCCT No data
Right 1159152579 18:64538811-64538833 CAGGCAGCAAGGTGGGACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159152579 Original CRISPR CAGGCAGCAAGGTGGGACTG GGG Intergenic
No off target data available for this crispr