ID: 1159153362

View in Genome Browser
Species Human (GRCh38)
Location 18:64549867-64549889
Sequence TGTCCATTGCGGGAAGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159153356_1159153362 12 Left 1159153356 18:64549832-64549854 CCAATGATTCTTTGTTGACTTTT No data
Right 1159153362 18:64549867-64549889 TGTCCATTGCGGGAAGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159153362 Original CRISPR TGTCCATTGCGGGAAGTGGG TGG Intergenic
No off target data available for this crispr