ID: 1159156140

View in Genome Browser
Species Human (GRCh38)
Location 18:64585680-64585702
Sequence TGTGAACTTAAAATTGATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159156140_1159156141 27 Left 1159156140 18:64585680-64585702 CCTGCATCAATTTTAAGTTCACA No data
Right 1159156141 18:64585730-64585752 ACCCTATGTCTGCCAGTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159156140 Original CRISPR TGTGAACTTAAAATTGATGC AGG (reversed) Intergenic
No off target data available for this crispr