ID: 1159156427

View in Genome Browser
Species Human (GRCh38)
Location 18:64589188-64589210
Sequence CCTGCAGCTGGTTATCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159156423_1159156427 7 Left 1159156423 18:64589158-64589180 CCTAGCAGCTCAGCAAATGAGAG No data
Right 1159156427 18:64589188-64589210 CCTGCAGCTGGTTATCTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159156427 Original CRISPR CCTGCAGCTGGTTATCTGTG TGG Intergenic
No off target data available for this crispr