ID: 1159158802

View in Genome Browser
Species Human (GRCh38)
Location 18:64618059-64618081
Sequence AACGGTATGAATGGTGTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159158796_1159158802 10 Left 1159158796 18:64618026-64618048 CCAAACACGTGACAGACTGGTTT No data
Right 1159158802 18:64618059-64618081 AACGGTATGAATGGTGTGGTTGG No data
1159158794_1159158802 29 Left 1159158794 18:64618007-64618029 CCATTATCACAGGGTTAATCCAA No data
Right 1159158802 18:64618059-64618081 AACGGTATGAATGGTGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159158802 Original CRISPR AACGGTATGAATGGTGTGGT TGG Intergenic
No off target data available for this crispr