ID: 1159159543

View in Genome Browser
Species Human (GRCh38)
Location 18:64625405-64625427
Sequence GCGCCTCCTTCAGCTGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159159543_1159159544 -7 Left 1159159543 18:64625405-64625427 CCTGGGTCAGCTGAAGGAGGCGC No data
Right 1159159544 18:64625421-64625443 GAGGCGCATCCTTGAAGATAAGG No data
1159159543_1159159546 5 Left 1159159543 18:64625405-64625427 CCTGGGTCAGCTGAAGGAGGCGC No data
Right 1159159546 18:64625433-64625455 TGAAGATAAGGTCTGAGCATAGG No data
1159159543_1159159547 12 Left 1159159543 18:64625405-64625427 CCTGGGTCAGCTGAAGGAGGCGC No data
Right 1159159547 18:64625440-64625462 AAGGTCTGAGCATAGGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159159543 Original CRISPR GCGCCTCCTTCAGCTGACCC AGG (reversed) Intergenic
No off target data available for this crispr