ID: 1159160562

View in Genome Browser
Species Human (GRCh38)
Location 18:64638831-64638853
Sequence CTAGTATTTAATATCCATAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159160562_1159160564 14 Left 1159160562 18:64638831-64638853 CCCATATGGATATTAAATACTAG No data
Right 1159160564 18:64638868-64638890 TGAAGACAGTTTCATTTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159160562 Original CRISPR CTAGTATTTAATATCCATAT GGG (reversed) Intergenic
No off target data available for this crispr