ID: 1159166808

View in Genome Browser
Species Human (GRCh38)
Location 18:64713163-64713185
Sequence GGTGTGGAGCAACACAGACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159166808_1159166816 23 Left 1159166808 18:64713163-64713185 CCAGGTCTGTGTTGCTCCACACC No data
Right 1159166816 18:64713209-64713231 AAATGTTACTGAAACACCAGGGG No data
1159166808_1159166815 22 Left 1159166808 18:64713163-64713185 CCAGGTCTGTGTTGCTCCACACC No data
Right 1159166815 18:64713208-64713230 TAAATGTTACTGAAACACCAGGG No data
1159166808_1159166814 21 Left 1159166808 18:64713163-64713185 CCAGGTCTGTGTTGCTCCACACC No data
Right 1159166814 18:64713207-64713229 ATAAATGTTACTGAAACACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159166808 Original CRISPR GGTGTGGAGCAACACAGACC TGG (reversed) Intergenic
No off target data available for this crispr