ID: 1159169722

View in Genome Browser
Species Human (GRCh38)
Location 18:64750172-64750194
Sequence TTTGCTACACATTTCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159169720_1159169722 9 Left 1159169720 18:64750140-64750162 CCTGAGCAGCAAACTTGACTCTC No data
Right 1159169722 18:64750172-64750194 TTTGCTACACATTTCTACCAGGG No data
1159169719_1159169722 22 Left 1159169719 18:64750127-64750149 CCTTGACATGGCTCCTGAGCAGC No data
Right 1159169722 18:64750172-64750194 TTTGCTACACATTTCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159169722 Original CRISPR TTTGCTACACATTTCTACCA GGG Intergenic
No off target data available for this crispr