ID: 1159174293

View in Genome Browser
Species Human (GRCh38)
Location 18:64813943-64813965
Sequence CACTGTTGGCAGGAGTAGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159174293_1159174301 14 Left 1159174293 18:64813943-64813965 CCGCCCTACTCCTGCCAACAGTG No data
Right 1159174301 18:64813980-64814002 CCCTTGGTCTGGACAGCACATGG No data
1159174293_1159174299 3 Left 1159174293 18:64813943-64813965 CCGCCCTACTCCTGCCAACAGTG No data
Right 1159174299 18:64813969-64813991 GTCTCTCTCTGCCCTTGGTCTGG No data
1159174293_1159174303 24 Left 1159174293 18:64813943-64813965 CCGCCCTACTCCTGCCAACAGTG No data
Right 1159174303 18:64813990-64814012 GGACAGCACATGGCAATTCCAGG No data
1159174293_1159174298 -2 Left 1159174293 18:64813943-64813965 CCGCCCTACTCCTGCCAACAGTG No data
Right 1159174298 18:64813964-64813986 TGAGTGTCTCTCTCTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159174293 Original CRISPR CACTGTTGGCAGGAGTAGGG CGG (reversed) Intergenic
No off target data available for this crispr