ID: 1159178982

View in Genome Browser
Species Human (GRCh38)
Location 18:64876890-64876912
Sequence CTTTATTAGCAGAATGAGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159178982_1159178987 5 Left 1159178982 18:64876890-64876912 CCATTCTCATTCTGCTAATAAAG No data
Right 1159178987 18:64876918-64876940 CGAGACTGGGTCATTTATAAAGG No data
1159178982_1159178983 -9 Left 1159178982 18:64876890-64876912 CCATTCTCATTCTGCTAATAAAG No data
Right 1159178983 18:64876904-64876926 CTAATAAAGACACCCGAGACTGG No data
1159178982_1159178984 -8 Left 1159178982 18:64876890-64876912 CCATTCTCATTCTGCTAATAAAG No data
Right 1159178984 18:64876905-64876927 TAATAAAGACACCCGAGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159178982 Original CRISPR CTTTATTAGCAGAATGAGAA TGG (reversed) Intergenic
No off target data available for this crispr