ID: 1159182147

View in Genome Browser
Species Human (GRCh38)
Location 18:64922164-64922186
Sequence AAGTGGGAGAAATCCTTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1159182147_1159182153 30 Left 1159182147 18:64922164-64922186 CCAGTCAAGGATTTCTCCCACTT No data
Right 1159182153 18:64922217-64922239 CTACACAACTGAATCATCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1159182147 Original CRISPR AAGTGGGAGAAATCCTTGAC TGG (reversed) Intergenic
No off target data available for this crispr